ID: 1077661421

View in Genome Browser
Species Human (GRCh38)
Location 11:4071898-4071920
Sequence TGGATTTATTTCCATGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 172}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077661416_1077661421 1 Left 1077661416 11:4071874-4071896 CCTCTACTGAGGTAGCAGACTTA 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1077661421 11:4071898-4071920 TGGATTTATTTCCATGGGCTGGG 0: 1
1: 0
2: 2
3: 18
4: 172
1077661414_1077661421 12 Left 1077661414 11:4071863-4071885 CCAGGGTGCTGCCTCTACTGAGG 0: 1
1: 0
2: 0
3: 18
4: 198
Right 1077661421 11:4071898-4071920 TGGATTTATTTCCATGGGCTGGG 0: 1
1: 0
2: 2
3: 18
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077661421 Original CRISPR TGGATTTATTTCCATGGGCT GGG Intronic
902182314 1:14698480-14698502 TGGAATTATTTCCATATGCACGG - Intronic
908038820 1:60085318-60085340 GGCATTCATTTCCAAGGGCTGGG - Intergenic
908463394 1:64367824-64367846 TGGAAGTATTACCATGTGCTGGG + Intergenic
913293614 1:117297958-117297980 TGGATTCTGTCCCATGGGCTAGG - Intergenic
913357336 1:117937511-117937533 TGGATTTGTTTCTGTGGGATAGG + Intronic
921365561 1:214370401-214370423 TGGATTTCATCCCATGGGCACGG + Intronic
921461132 1:215428467-215428489 TGGTGTTATTTCCAAGGCCTCGG + Intergenic
922034298 1:221833407-221833429 GGGATGCATTTCCAGGGGCTTGG + Intergenic
922340702 1:224652749-224652771 TAGTTTTGCTTCCATGGGCTTGG - Intronic
1064862146 10:19838419-19838441 TGTATTTATTATCATGGGCTAGG - Intronic
1064950947 10:20849516-20849538 TGGTTTTGTTACCATGGGGTTGG + Intronic
1068579098 10:58718925-58718947 TGGTTTTATTTCTATGTGTTGGG + Intronic
1068583203 10:58766257-58766279 TGGATATAGTGCCATGGGGTGGG + Intronic
1069024665 10:63525933-63525955 TGTATTTAATCCCATGGGGTAGG - Intronic
1069453174 10:68533575-68533597 TGAAGTTATTTCCATGGTGTGGG + Intergenic
1072964386 10:99958615-99958637 TGTATCTACTACCATGGGCTTGG + Intronic
1075604735 10:123796385-123796407 TGGCATTTTTTCCACGGGCTAGG + Intronic
1077349530 11:2086037-2086059 TGGGGTGATTTCCAAGGGCTGGG + Intergenic
1077661421 11:4071898-4071920 TGGATTTATTTCCATGGGCTGGG + Intronic
1077677567 11:4209873-4209895 TGGAATTATGGCTATGGGCTTGG + Intergenic
1080658315 11:34275354-34275376 TGGATGTTTTTCCCTGGGGTAGG - Intronic
1082997902 11:59267475-59267497 TGGCTTTATGGCCAGGGGCTGGG - Intergenic
1085032835 11:73283118-73283140 TGGATCTAATTCCATGGGCTGGG + Intronic
1086394113 11:86396712-86396734 TGGTTTTATTTCTATAAGCTTGG - Intronic
1087686033 11:101266265-101266287 CAGATTTAATTCCATGGGCTAGG - Intergenic
1091548425 12:1519662-1519684 TGGATTGCTTGACATGGGCTTGG + Intergenic
1091637228 12:2206218-2206240 TGGATCTCCTTCCAAGGGCTGGG - Intronic
1092800579 12:12161835-12161857 TGGGTTTACTTCAATAGGCTTGG + Intronic
1093038297 12:14353617-14353639 TGGAATTATGTCCATGTCCTAGG + Intergenic
1093339426 12:17953560-17953582 GAAATTTATTTCCATGGGCTGGG - Intergenic
1093658135 12:21721358-21721380 TGGATCTATTTACATGGGTATGG + Intronic
1095846549 12:46751805-46751827 TGTATTTATTTCCTTGGGCTTGG + Intergenic
1096849564 12:54426974-54426996 TGGATTTATTTCCCTGAAGTGGG + Intergenic
1099031641 12:77532674-77532696 TTGATATATTTCCATGTCCTTGG + Intergenic
1100420979 12:94433148-94433170 TGGAATTTATTCCATGGTCTTGG + Intronic
1101740525 12:107496406-107496428 TGGAATTCTTTCCATGGGAGAGG + Intronic
1103167733 12:118784716-118784738 TGGATCTATTTACAGGGGCAGGG + Intergenic
1104091313 12:125520158-125520180 TGGATTTCTTCTCCTGGGCTTGG + Intronic
1104328163 12:127819585-127819607 TGAATTAATTACCAAGGGCTGGG + Intergenic
1104522497 12:129488270-129488292 TGGGTTCATGTCCATGGGCCTGG + Intronic
1105391388 13:19982202-19982224 TGGATTTATTTGGATGGGAAAGG + Intronic
1106920124 13:34554119-34554141 TGGGTTAATATCTATGGGCTTGG - Intergenic
1108161363 13:47643590-47643612 TGTATTATTTTACATGGGCTAGG + Intergenic
1109562449 13:64070044-64070066 TGCATTTATTTCCAGGCTCTGGG - Intergenic
1110001320 13:70205612-70205634 TGTATTTATTTGCATTGGCAAGG + Intergenic
1111618064 13:90686802-90686824 TTGAACTATTTCCCTGGGCTGGG - Intergenic
1111743931 13:92241573-92241595 TGGTTTTATTTCTGTGGGATTGG + Intronic
1111775944 13:92662138-92662160 TTGAGTTATTACGATGGGCTGGG - Intronic
1112133659 13:96552111-96552133 TTGGTTTATTTCCATGGTTTTGG + Intronic
1115116503 14:29886464-29886486 TGGTTTTGTTTCCTTTGGCTGGG - Intronic
1116121587 14:40727671-40727693 TGGGTTTTTTTCCATTGGCATGG + Intergenic
1120957689 14:90097391-90097413 TGGATTAGTTTCCATGGGAATGG - Intronic
1121227796 14:92334187-92334209 TGGATTTACTACTATGGGCAGGG + Intronic
1122493110 14:102133439-102133461 TGGTTTTATTACCCAGGGCTTGG + Intronic
1128928907 15:71685932-71685954 TGGATATATTTCCATTTACTTGG - Intronic
1130555099 15:84917110-84917132 AGGATTTGTTTCTATGTGCTGGG - Intronic
1133398282 16:5465728-5465750 TGGATGTTTTTCCATGGACCAGG + Intergenic
1135949784 16:26903285-26903307 TGAGTTTATTTCCAAGGACTGGG - Intergenic
1136296206 16:29304575-29304597 TGTTTTTATTTCCATGTGCACGG - Intergenic
1137921908 16:52498313-52498335 TTGATGTATTTCCATTAGCTAGG - Intronic
1140044165 16:71429460-71429482 TGGCTTTTTTTCCAGGAGCTGGG + Intergenic
1140221398 16:73047228-73047250 AGCATTTATTTCCTTGGGCAGGG - Intronic
1140865963 16:79062385-79062407 GGGATTTATTTCCATAGGGAAGG + Intronic
1140982961 16:80128240-80128262 TCCTTTTATTCCCATGGGCTTGG + Intergenic
1142057793 16:88010660-88010682 TGTTTTTATTTCCATGTGCACGG - Intronic
1203012611 16_KI270728v1_random:312365-312387 TGGATTTTTTGCAATTGGCTTGG - Intergenic
1203030946 16_KI270728v1_random:585524-585546 TGGATTTTTTGCAATTGGCTTGG - Intergenic
1203040775 16_KI270728v1_random:748907-748929 TGGATTTTTTGCAATTGGCTTGG + Intergenic
1145011367 17:19370174-19370196 TGGATTTTATTCCATGAGATGGG + Intronic
1149123376 17:53197351-53197373 TTGTTTAATTTCCATGGACTTGG + Intergenic
1149248646 17:54741790-54741812 TAGATTTATTTCAGTGTGCTGGG + Intergenic
1149641503 17:58205884-58205906 TGGCTTTATTTCCACAGGGTAGG + Exonic
1152345634 17:79748887-79748909 TGTTTTTATTTTGATGGGCTTGG - Intergenic
1152626846 17:81391715-81391737 TGGAGTCACTTCCATGGGCCTGG - Intergenic
1155978397 18:32156102-32156124 TGGATTTATCTCCTAGGACTGGG + Intronic
1157415002 18:47494953-47494975 AGGTTTTCTTTCCATAGGCTAGG - Intergenic
1159235571 18:65668481-65668503 TGGATATATATCCATTTGCTGGG + Intergenic
1159432667 18:68375114-68375136 AGTATTTTTTTCCATGTGCTGGG - Intergenic
1159547925 18:69863947-69863969 TGGATCCATTTCCCTGGTCTTGG - Exonic
1166352870 19:42208591-42208613 TGGATTTTATTCCATGCGCCAGG - Intronic
1166583652 19:43926019-43926041 GGGATATATTTCCATCGCCTCGG + Intronic
1166601515 19:44099423-44099445 TGGATTTTCTTCCCTGGTCTGGG - Intronic
1167601443 19:50457346-50457368 TGGGTTTATGGCCATGGGCTGGG - Intronic
1168182900 19:54674947-54674969 TGGTTTTATTTCCTAGGGCTGGG - Intronic
925250379 2:2430787-2430809 TGCATTCATTTTCATGAGCTAGG - Intergenic
925835987 2:7947530-7947552 TGGGTTTATTTGCAAGGGCGGGG - Intergenic
926478082 2:13353038-13353060 TGGATTTATTTATCTGGGCGTGG - Intergenic
928935122 2:36668264-36668286 TGGATTTAATTCCAAGTGCAAGG + Intergenic
933513751 2:83275007-83275029 TGGATGAATTTGCATGGGCCAGG + Intergenic
935545275 2:104394614-104394636 TGGATTTATACCCGTGTGCTTGG - Intergenic
935744087 2:106175834-106175856 TGTATTTATACCCATGGGCTTGG - Intronic
937702223 2:124876478-124876500 TGCAGTTATAGCCATGGGCTAGG + Intronic
939699238 2:145369544-145369566 TGGATTTGTTACCAGGTGCTAGG + Intergenic
939789077 2:146549292-146549314 TGGAATTATTTCATTGGTCTTGG - Intergenic
945210031 2:207373249-207373271 TGGTTTTATTTCCTTGTGGTAGG - Intergenic
947025420 2:225732652-225732674 TTGAATTATTTCCATGGGCGGGG + Intergenic
947063198 2:226190174-226190196 TGGGTCTATTTGCATAGGCTTGG - Intergenic
948772498 2:240258787-240258809 TGGAGCTGTTTCCATGGCCTAGG - Intergenic
1168899574 20:1351490-1351512 TTGTTTAATTTCCATGTGCTTGG + Intronic
1173245510 20:41335027-41335049 AGGAATTGTTTCCATTGGCTGGG + Intergenic
1174709080 20:52686171-52686193 TGGAGGACTTTCCATGGGCTAGG - Intergenic
1177208152 21:18034539-18034561 TGGAGTTAATGCCATGGCCTGGG + Intronic
1177913997 21:27065305-27065327 TTTTTTTATTTCCGTGGGCTTGG - Intergenic
1181376481 22:22462559-22462581 TGGTTCTATTTCCTGGGGCTGGG + Intergenic
1182663136 22:31939239-31939261 TGGTTTTATTATCATTGGCTGGG + Intronic
951384132 3:22024425-22024447 TGGAGTTATTTCCTTGGTTTTGG + Intronic
954645145 3:52126795-52126817 TGGGTTTGTTACCATGGGGTGGG - Intronic
956959119 3:74376701-74376723 TGAATTTTTTTCCATGGACTGGG - Intronic
957164852 3:76659262-76659284 TTGATATATTTCCAGGGGTTGGG + Intronic
965748224 3:171947784-171947806 TGTTTTTATTTCTATGGGGTTGG + Intergenic
967011513 3:185439225-185439247 TGGATTCATTTCCTTGGGGAAGG + Intronic
968183070 3:196611543-196611565 TGGATTTATTTCTAGGGATTTGG + Intergenic
968187378 3:196642565-196642587 TGGATTGATTCTCATGGGCTTGG + Intronic
969066645 4:4487660-4487682 TGGGTTTGTTTTCATGGGTTTGG - Intronic
970353419 4:15228779-15228801 TGCCTTTATCTCCATGGTCTTGG + Intergenic
971415376 4:26422165-26422187 TACATTTATTTCCATTGGATTGG + Intronic
971590504 4:28462204-28462226 TGAATTTATTTCTGTGGGCTGGG - Intergenic
971731977 4:30395825-30395847 TGCAGTATTTTCCATGGGCTGGG + Intergenic
972980697 4:44697223-44697245 TGTATTTATTTTCATGTACTTGG - Intronic
974494565 4:62609772-62609794 TTGATTTATTTCCATTGGGATGG + Intergenic
974615813 4:64279836-64279858 TGAATGTATTTGCATGGGATTGG - Exonic
976020458 4:80617701-80617723 TGGATTCATTTCCATAGTTTTGG - Intronic
976192360 4:82500080-82500102 TGCATTTCTTTCCACGGGGTAGG - Intronic
976548134 4:86361515-86361537 TGATTTAATTTCCATGGGATTGG - Intronic
976670983 4:87653680-87653702 TGGATTTATTGCCCTGGGATGGG + Intronic
978965821 4:114740147-114740169 TGTATTTAGGTACATGGGCTCGG - Intergenic
979827926 4:125262696-125262718 TCACTTTATTTGCATGGGCTTGG - Intergenic
980719940 4:136682542-136682564 TGGTTTTATTTCCTTCGGATTGG + Intergenic
982144665 4:152372339-152372361 TGGATTTAGTTCCATGCTCTTGG + Intronic
983034927 4:162852028-162852050 TGAATTTATTTCCATGGGGGCGG + Intergenic
983542714 4:168930456-168930478 TGGATTTACTTCTATTGGCAGGG + Intronic
983853356 4:172611068-172611090 TGGATGTCATTCCATGAGCTAGG + Intronic
984010982 4:174371286-174371308 AAAATGTATTTCCATGGGCTTGG + Intergenic
987503099 5:18738196-18738218 TGGATTTATTATGATGGTCTTGG - Intergenic
987861067 5:23488870-23488892 TGTTTTTATTTCTATGGGGTTGG + Intergenic
989451201 5:41588371-41588393 TGGAATTTCTTCCATGGCCTGGG - Intergenic
989534341 5:42546634-42546656 TGGTATTAATTCCATGTGCTAGG + Intronic
990157903 5:52900422-52900444 TGGATTTTTTTCCCTAGGTTAGG - Intronic
990242994 5:53834406-53834428 TGTATTTATTGCCATTGTCTTGG + Intergenic
990257950 5:53991045-53991067 TGGAATTATACCCATGGGGTGGG - Intronic
990572308 5:57091670-57091692 TGGCTTTATTGCAATGGTCTGGG + Intergenic
990676852 5:58196306-58196328 TTAATCTCTTTCCATGGGCTTGG + Intergenic
991198978 5:63968466-63968488 TGTATTAGTTTCCAAGGGCTAGG - Intergenic
991623572 5:68572354-68572376 AGAATGTATTTCCAAGGGCTGGG - Intergenic
992952252 5:81871540-81871562 ATGATTTATTTCCAGGGCCTAGG + Intergenic
994907900 5:105864572-105864594 TATTTTTATTTCCATGGGATTGG - Intergenic
995956052 5:117778103-117778125 TTCATTTATGTCCCTGGGCTTGG + Intergenic
996690258 5:126332999-126333021 TGGATTGATTTCAATCTGCTGGG - Intergenic
998097657 5:139405602-139405624 TGCGTTTATTTTCATGGACTTGG + Intergenic
999036197 5:148353349-148353371 AGGGTTTATTTCCATGGCCTGGG - Intergenic
1000582399 5:163050167-163050189 TGGTTTTATTTCTGTGGGGTTGG - Intergenic
1000779137 5:165457863-165457885 TGCCTTTATTTCAATGGTCTGGG - Intergenic
1000965428 5:167650102-167650124 TGGCTTTATTTCTCTGGCCTTGG - Intronic
1003950578 6:11111792-11111814 TGGATTTTTTTCCTTGGGGTGGG + Intronic
1003961238 6:11211207-11211229 TGGATTGATGTCAAAGGGCTGGG - Intronic
1006033439 6:31194347-31194369 TGAATTTCTTTCCCTGGGCCAGG - Intergenic
1006896295 6:37473285-37473307 GGGATCTATTTCCATCTGCTTGG - Intronic
1007239769 6:40416655-40416677 TGGACTTATTGCCAAGGGCTTGG - Intronic
1007790381 6:44305134-44305156 TGGCTTGATGTCCATGCGCTTGG - Exonic
1008749266 6:54712276-54712298 TGGATGTAATTCCATTGGCTTGG - Intergenic
1012422448 6:99079619-99079641 TTGATTTATTTCCTTGGTCAGGG + Intergenic
1014314232 6:119843223-119843245 TGGATTTATTATCATGGGAATGG - Intergenic
1015360633 6:132335290-132335312 TTGCTTTATTTCCCTGTGCTGGG + Intronic
1016015040 6:139175220-139175242 TTGCTTTATTTCCAAGTGCTTGG + Intronic
1016832805 6:148449902-148449924 TGGATTAATTTCCATGGAAATGG - Intronic
1020819711 7:12951832-12951854 TGGATTTATTTTCATGACCTAGG - Intergenic
1021606701 7:22415476-22415498 TGGATTTATTCCCATGATATTGG + Intergenic
1022749414 7:33208102-33208124 TTAAGTTATTTCTATGGGCTGGG - Intronic
1024767412 7:52676062-52676084 TGTATTTCTTTGCATTGGCTGGG - Intergenic
1026524665 7:71143630-71143652 TGGACTTAATTGCATAGGCTTGG + Intronic
1027501757 7:78960764-78960786 TGGAGTTAGTTCCATGTTCTGGG - Intronic
1031701103 7:124928076-124928098 TGCATTTTTTTCCATGCGTTAGG - Intronic
1036507748 8:9370838-9370860 AGTATTTATTTCCAGGTGCTGGG + Intergenic
1037483556 8:19326910-19326932 TGGATTTATTCCCAGGTGATGGG - Intronic
1039151412 8:34510676-34510698 AGGAATTATTTTAATGGGCTGGG + Intergenic
1041413029 8:57577441-57577463 CAGATTTATTTCCACGGGCCAGG + Intergenic
1041500996 8:58538577-58538599 TGGATTTAGTTATTTGGGCTTGG + Intergenic
1044139935 8:88637718-88637740 TTGATTTTTTTCCTTGGGGTGGG - Intergenic
1045320325 8:101077397-101077419 TGGATTTATATCATGGGGCTAGG + Intergenic
1045842634 8:106597671-106597693 TGGAATTATTTCCATATTCTAGG + Intronic
1046314032 8:112477388-112477410 TGGATTTGCTACTATGGGCTTGG - Intronic
1050192954 9:3048001-3048023 TGGTTTAATTTCCATGTACTTGG - Intergenic
1051357237 9:16250821-16250843 TGGTTTTATTTTCATGAACTAGG + Intronic
1052826839 9:33182747-33182769 TGGATTTACTTCATTTGGCTAGG + Intergenic
1058530544 9:105901446-105901468 TGGCATTATGTCCATGTGCTTGG + Intergenic
1185522340 X:750304-750326 TGTATTCATTGCCAAGGGCTGGG + Intergenic
1189615258 X:42776668-42776690 GGGATTGATGTGCATGGGCTGGG + Intergenic
1192067404 X:67901246-67901268 TGTACTGATTTCCATGTGCTTGG + Intergenic
1194365536 X:93009331-93009353 TGGGTTTTTTTCCATTTGCTTGG + Intergenic
1194533237 X:95076220-95076242 TGGCTTTATTTCCTGGGGTTGGG + Intergenic
1197721177 X:129745746-129745768 TGGATTTCATTCAATGGGCCAGG - Intronic
1199138709 X:144285188-144285210 TTGTTTTATTTCCATGTGTTTGG + Intergenic
1200843980 Y:7812671-7812693 TGGAAATATTTCCCTTGGCTGGG + Intergenic