ID: 1077667773

View in Genome Browser
Species Human (GRCh38)
Location 11:4129512-4129534
Sequence AGTTACATCGGGCATATAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 64}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077667773 Original CRISPR AGTTACATCGGGCATATAAA TGG Intronic
902153951 1:14468359-14468381 AGTAAGACCGGGTATATAAAGGG - Intergenic
903911059 1:26725701-26725723 ACTTACATGGGGGCTATAAAGGG - Intronic
907840450 1:58152092-58152114 AGATACATCAGGCAAATATATGG + Intronic
909374952 1:74929550-74929572 TGTTCCTTCGGGAATATAAAGGG - Intergenic
911575514 1:99572760-99572782 AATTATATAGTGCATATAAATGG - Intergenic
913560249 1:120011557-120011579 AGTTACTTCGGGTATATACCTGG - Intronic
913637874 1:120782013-120782035 AGTTACTTCGGGTATATACCTGG + Intergenic
914280838 1:146170972-146170994 AGTTACTTCGGGTATATACCTGG - Intronic
914624762 1:149449336-149449358 AGTTACTTCGGGTATATACCTGG + Intergenic
918301950 1:183212701-183212723 AGTTTCTAGGGGCATATAAAAGG - Intronic
920714697 1:208328605-208328627 TGTTACACCGGGCTTATCAATGG + Intergenic
923865830 1:237938581-237938603 AGTTACATAAAGCATATGAAGGG - Intergenic
1064589940 10:16879060-16879082 AGTTCCTTTGGGTATATAAATGG + Intronic
1075546315 10:123357739-123357761 AGTTTTATTAGGCATATAAAAGG - Intergenic
1077667773 11:4129512-4129534 AGTTACATCGGGCATATAAATGG + Intronic
1078380035 11:10831764-10831786 AGTTGCATCTGGCAGAAAAAGGG + Intronic
1080125603 11:28729755-28729777 ACATACATTGGGCATATAAAGGG - Intergenic
1092809430 12:12258564-12258586 TGGTACATGGTGCATATAAAGGG + Intronic
1095909343 12:47410065-47410087 AGCTACATAGGGCTTAGAAAGGG + Intergenic
1098772010 12:74564230-74564252 ACTTACATCAGGCCTAGAAATGG + Intergenic
1106650280 13:31682963-31682985 TGTTATATTGGGCATCTAAAGGG - Intergenic
1116927167 14:50651461-50651483 AGTTACATAGGATATTTAAAAGG - Intronic
1124398354 15:29325780-29325802 AGATACATAGAGCATAAAAAAGG + Intronic
1125011685 15:34883718-34883740 AATTACAGCGGTCCTATAAAGGG - Intronic
1127111139 15:55671987-55672009 AGTTACATGGGTCATATGTAAGG + Intronic
1134151684 16:11810373-11810395 ATTTACATAGGGCATACCAATGG - Intergenic
1137038502 16:35588387-35588409 AGTTACAAAGGGCATAAAAGAGG - Intergenic
1151763468 17:76120590-76120612 AGTGACATGGCGCATATAAAAGG + Intronic
1159675891 18:71283970-71283992 ATTTACATAGGGCATAAAAATGG + Intergenic
1159679990 18:71337537-71337559 GGTTACATATGGCTTATAAAAGG - Intergenic
1162173100 19:8806819-8806841 AATGACATCTGACATATAAAGGG - Exonic
927332530 2:21882710-21882732 AGATACATGGGGCAGATAAATGG + Intergenic
929118520 2:38465032-38465054 ATTTACATGGGGCATTTACATGG - Intergenic
932205616 2:69878950-69878972 AGTTACAGCAGATATATAAAGGG - Exonic
933093771 2:78152597-78152619 AATTACATCCCGCATTTAAAAGG + Intergenic
933096111 2:78183391-78183413 AGTCTCATTTGGCATATAAATGG - Intergenic
937702964 2:124884854-124884876 AGTTATTTGGGGGATATAAAGGG + Intronic
941182728 2:162280495-162280517 TGTTACATGAGGCATATCAAAGG + Intronic
945565919 2:211399168-211399190 ATTCACATGGGGCATATAATGGG - Intronic
1169673211 20:8127516-8127538 AGTTATTTAGGGCATAGAAAGGG + Intergenic
1171500960 20:25592993-25593015 AGATACAGCTGGCATGTAAAAGG + Intergenic
1181410247 22:22713379-22713401 AGATACATCAGGCATAAATATGG + Intergenic
1184314815 22:43677738-43677760 AGTTACATCCTGTATATAAAGGG + Intronic
951472896 3:23074791-23074813 AGTTTCTTCTGGGATATAAACGG + Intergenic
951644842 3:24878492-24878514 AGGTAGATGGGGCATATCAATGG + Intergenic
970953346 4:21781787-21781809 AATTATATGGGGTATATAAATGG + Intronic
973026327 4:45276876-45276898 AGTTACATAGGTCACATAACTGG - Intergenic
977655467 4:99516297-99516319 AGTAACATCAGGCATCCAAATGG + Intronic
978128972 4:105170762-105170784 AATTACATTGTGCATTTAAAAGG + Intronic
981455959 4:144953735-144953757 AGATACAGGAGGCATATAAAAGG + Intergenic
982355073 4:154457653-154457675 TGTTACATCTGGCTTATAACAGG + Intronic
1002288884 5:178185784-178185806 AGTTACAGCAGATATATAAAGGG + Intergenic
1004183261 6:13398949-13398971 AGTAACACTGGGCATTTAAAAGG + Intronic
1004954981 6:20719769-20719791 AGTTTCATGGGGAACATAAAAGG - Intronic
1010290357 6:74129425-74129447 AGTTAGCTAGGGCTTATAAAAGG + Intergenic
1010938918 6:81892727-81892749 AGTCTCATGGGGCTTATAAAAGG - Intergenic
1013021321 6:106222792-106222814 AATTACCTCAGGTATATAAAGGG + Intronic
1024504196 7:50147482-50147504 ATTTACATCAAGCATTTAAAAGG + Intronic
1027620324 7:80477175-80477197 AGTTAAAATGGGCAAATAAATGG - Intronic
1030545560 7:110890789-110890811 AGTTACCTAGGTCTTATAAATGG + Intronic
1031082510 7:117272261-117272283 AGTTACTTCTGGCATATAGTTGG + Intergenic
1037968457 8:23152609-23152631 ACTTACATTGGGCCTAAAAATGG + Intronic
1048922964 8:139247291-139247313 AGTCACATCTGGCCTATGAAGGG - Intergenic
1052638703 9:31136187-31136209 ATTTACATAGGTCATTTAAAAGG + Intergenic
1052671220 9:31559999-31560021 ACTTACAGTGGGCAAATAAAAGG + Intergenic
1058063226 9:100521672-100521694 ATTTAGGTCGGGTATATAAAAGG - Intronic
1061917226 9:133761664-133761686 GGTGGCATCGGGCATACAAATGG - Intergenic
1186652519 X:11576523-11576545 AGAAACATCAAGCATATAAAAGG + Intronic
1197795880 X:130298256-130298278 AGGTACATCATGCATATGAAAGG - Intergenic
1201980759 Y:19908113-19908135 AGTTACACAGGGCATATAGGAGG + Intergenic