ID: 1077669104

View in Genome Browser
Species Human (GRCh38)
Location 11:4141602-4141624
Sequence TGGGATCCTGAAAATTGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077669099_1077669104 15 Left 1077669099 11:4141564-4141586 CCTTTGCTATTAAAGTGAGGATA No data
Right 1077669104 11:4141602-4141624 TGGGATCCTGAAAATTGGAATGG No data
1077669097_1077669104 27 Left 1077669097 11:4141552-4141574 CCTTGCAGTGTGCCTTTGCTATT No data
Right 1077669104 11:4141602-4141624 TGGGATCCTGAAAATTGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077669104 Original CRISPR TGGGATCCTGAAAATTGGAA TGG Intergenic
No off target data available for this crispr