ID: 1077674057

View in Genome Browser
Species Human (GRCh38)
Location 11:4181973-4181995
Sequence TCTGGGGCGCCGAACCCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077674057_1077674064 -5 Left 1077674057 11:4181973-4181995 CCCTCAGGGTTCGGCGCCCCAGA No data
Right 1077674064 11:4181991-4182013 CCAGAAAGCCAGGAGGCCTCAGG No data
1077674057_1077674065 2 Left 1077674057 11:4181973-4181995 CCCTCAGGGTTCGGCGCCCCAGA No data
Right 1077674065 11:4181998-4182020 GCCAGGAGGCCTCAGGCCCCTGG No data
1077674057_1077674067 5 Left 1077674057 11:4181973-4181995 CCCTCAGGGTTCGGCGCCCCAGA No data
Right 1077674067 11:4182001-4182023 AGGAGGCCTCAGGCCCCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077674057 Original CRISPR TCTGGGGCGCCGAACCCTGA GGG (reversed) Intergenic
No off target data available for this crispr