ID: 1077677567

View in Genome Browser
Species Human (GRCh38)
Location 11:4209873-4209895
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077677563_1077677567 -6 Left 1077677563 11:4209856-4209878 CCTGATTTGTATGATGGTGGAAT No data
Right 1077677567 11:4209873-4209895 TGGAATTATGGCTATGGGCTTGG No data
1077677560_1077677567 26 Left 1077677560 11:4209824-4209846 CCACTGTGCTACTACTATCATTT No data
Right 1077677567 11:4209873-4209895 TGGAATTATGGCTATGGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077677567 Original CRISPR TGGAATTATGGCTATGGGCT TGG Intergenic
No off target data available for this crispr