ID: 1077691218

View in Genome Browser
Species Human (GRCh38)
Location 11:4344490-4344512
Sequence ACGAACACAAAGAAGGGCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077691218_1077691221 -1 Left 1077691218 11:4344490-4344512 CCATTGCCCTTCTTTGTGTTCGT No data
Right 1077691221 11:4344512-4344534 TGAGATAATTACCCTTATTCAGG No data
1077691218_1077691222 0 Left 1077691218 11:4344490-4344512 CCATTGCCCTTCTTTGTGTTCGT No data
Right 1077691222 11:4344513-4344535 GAGATAATTACCCTTATTCAGGG No data
1077691218_1077691227 29 Left 1077691218 11:4344490-4344512 CCATTGCCCTTCTTTGTGTTCGT No data
Right 1077691227 11:4344542-4344564 AAAAAATCATCTCTCCGGCCGGG No data
1077691218_1077691225 24 Left 1077691218 11:4344490-4344512 CCATTGCCCTTCTTTGTGTTCGT No data
Right 1077691225 11:4344537-4344559 ATTTTAAAAAATCATCTCTCCGG No data
1077691218_1077691226 28 Left 1077691218 11:4344490-4344512 CCATTGCCCTTCTTTGTGTTCGT No data
Right 1077691226 11:4344541-4344563 TAAAAAATCATCTCTCCGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077691218 Original CRISPR ACGAACACAAAGAAGGGCAA TGG (reversed) Intergenic
No off target data available for this crispr