ID: 1077699966

View in Genome Browser
Species Human (GRCh38)
Location 11:4432143-4432165
Sequence CATGTTTCCCAGCACTGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 224}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077699962_1077699966 -7 Left 1077699962 11:4432127-4432149 CCACTAGCAGCACCACCATGTTT 0: 1
1: 0
2: 0
3: 17
4: 178
Right 1077699966 11:4432143-4432165 CATGTTTCCCAGCACTGCCAGGG 0: 1
1: 0
2: 2
3: 18
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077699966 Original CRISPR CATGTTTCCCAGCACTGCCA GGG Intergenic
900457646 1:2785311-2785333 GATGTTTCCCAGGACTCGCAGGG - Intronic
901248435 1:7752705-7752727 CATGGTTACCAGCACTCCAAGGG - Intronic
901610786 1:10496322-10496344 CTTATATCCCAGCACTCCCACGG + Intronic
902381728 1:16055931-16055953 CCTGTTGCCCCTCACTGCCAGGG + Intronic
902584134 1:17427724-17427746 CATCTTTCCCTGCAGTGCCCAGG + Intronic
903173934 1:21569708-21569730 CAGGGGTCCCAGCACTACCAAGG - Intronic
903907890 1:26698140-26698162 GCTGTTTACCAGCACTTCCAGGG - Intronic
904679510 1:32219232-32219254 ATTCTTTCCCAGCACTCCCAGGG + Intronic
904946072 1:34199664-34199686 CAGGTTTCCCACCACTGCTGTGG + Intronic
906248887 1:44296145-44296167 CGTGCCTCCCAGCAGTGCCAGGG + Intronic
907034326 1:51202808-51202830 CATGTATCCCAGCTATGCCCTGG + Intergenic
911130424 1:94382130-94382152 CATGTTTCCCAGTCCTTCTAGGG + Intergenic
912505789 1:110154985-110155007 CATGTTTCCCAGAACGGCCACGG - Intronic
913225405 1:116694353-116694375 CATGTGTGGCAGCTCTGCCAGGG + Intronic
913964720 1:143366515-143366537 CTTGTTGCCCAGGAGTGCCATGG + Intergenic
914059092 1:144192118-144192140 CTTGTTGCCCAGGAGTGCCATGG + Intergenic
914120057 1:144774253-144774275 CTTGTTGCCCAGGAGTGCCATGG - Intergenic
915656675 1:157366559-157366581 CATGCATCCCAGCCCTGGCAGGG + Intergenic
916030908 1:160876806-160876828 TTTGTTTCCCAGCACTGCATTGG - Exonic
916038870 1:160945282-160945304 TCTGTTTCCCAGCACTGCATCGG - Exonic
916404589 1:164485381-164485403 CATGTGTCCCACGACTCCCAGGG - Intergenic
917479220 1:175396553-175396575 CAGCCTTCCCATCACTGCCAAGG - Exonic
918704335 1:187641650-187641672 CATGTGTCCCAGCCCTGGCAGGG - Intergenic
920278161 1:204823986-204824008 CCTCTTGCCCACCACTGCCAAGG - Intergenic
922336798 1:224624573-224624595 CATGCTTCCCATCCCTGCCTTGG + Intronic
923013910 1:230110886-230110908 CATTTTCCCCAGAACTCCCATGG - Intronic
924663168 1:246041539-246041561 CATGTATCCCAGTGTTGCCAGGG + Intronic
1063658529 10:8015684-8015706 CATGTTTCCGGGCACTGCGCAGG - Exonic
1064495177 10:15901994-15902016 CATTGTTCCCCGCTCTGCCATGG - Intergenic
1066067715 10:31774399-31774421 CATCTTATCCAGCACAGCCAAGG - Intergenic
1066701343 10:38132430-38132452 CATTTATCCCAGCAATGCAAGGG - Intergenic
1069598231 10:69686576-69686598 CTGGTTTCCCAGCAGTGGCAGGG + Intronic
1069907667 10:71741276-71741298 CATGATACCCAGCAATGCCAGGG - Intronic
1070428514 10:76313106-76313128 TTTGTGTCCCAGCTCTGCCAAGG + Intronic
1071118071 10:82247080-82247102 AATGTTTCCCCTCACTTCCAAGG - Intronic
1075040015 10:119100614-119100636 CAAGTTTCCAGGCACAGCCAAGG - Intergenic
1075304934 10:121359427-121359449 CATAATTCACACCACTGCCAGGG + Intergenic
1075450396 10:122547530-122547552 CATGTTTCCCAGGAATGTGAAGG + Intergenic
1076176863 10:128374935-128374957 CATGTTTCCCAACACAGGCCAGG + Intergenic
1077261281 11:1622219-1622241 CATCATTCCCAGCACTTCCTGGG + Intergenic
1077341725 11:2029210-2029232 CTGGCTTCCCAGGACTGCCAGGG + Intergenic
1077699966 11:4432143-4432165 CATGTTTCCCAGCACTGCCAGGG + Intergenic
1078797084 11:14602918-14602940 TATGTCTCCCCGCACAGCCATGG - Intronic
1078857809 11:15220775-15220797 CATGTTTCCAAGCTCTGCCCGGG - Intronic
1079365110 11:19802234-19802256 CAAGTTTCCCTAAACTGCCAGGG - Intronic
1079755723 11:24258492-24258514 CATATTTCCTAGTAATGCCATGG - Intergenic
1080729365 11:34933590-34933612 CTTGTTTCCAGGCATTGCCAGGG - Intronic
1081760392 11:45572704-45572726 CACCTTTCCCAGCACTCCCTGGG + Intergenic
1081776886 11:45681750-45681772 CATGGATCCCAGCACCCCCATGG - Intergenic
1084359276 11:68659267-68659289 CACGTTTGCCGGCACTGCCTGGG + Intergenic
1084637997 11:70405862-70405884 CATGGTTCCCACCACTGAGAAGG - Intronic
1089005246 11:115085339-115085361 CACCTTTCCCAGCACTGCACTGG - Intergenic
1090472324 11:126990970-126990992 CATTGCTCCCAGCATTGCCAAGG + Intronic
1090749725 11:129734946-129734968 CATGTTTCCCAGCAGAACTAGGG - Intergenic
1090853447 11:130591093-130591115 CAAATTTCCCAGCACTGGCTGGG + Intergenic
1202824711 11_KI270721v1_random:84399-84421 CTGGCTTCCCAGGACTGCCAGGG + Intergenic
1093340484 12:17967429-17967451 CAGTTTCCCCAGCACTGGCAGGG + Intergenic
1096686716 12:53292907-53292929 CAGGTTTCCACGCACAGCCAGGG - Exonic
1097817751 12:64094232-64094254 CATGTTTTAAAACACTGCCACGG + Intronic
1107426845 13:40302527-40302549 GACTTTTCCCAGCACAGCCAGGG + Intergenic
1107767380 13:43751207-43751229 CATCTTTCCCAGCTCAGCTAAGG + Intronic
1110324210 13:74195434-74195456 CATGTTTCACAAGCCTGCCAGGG + Intergenic
1110680265 13:78302664-78302686 AATGTGGTCCAGCACTGCCATGG + Intergenic
1115006199 14:28488424-28488446 TATTTTTCCCCCCACTGCCAAGG - Intergenic
1116390407 14:44384331-44384353 CATGTATCCCAGCCCCGGCATGG + Intergenic
1118550526 14:66944872-66944894 CATGCATCCCAGCCCTGGCAGGG + Intronic
1118564164 14:67120778-67120800 CAATTTTCCAAGTACTGCCAGGG + Intronic
1118822802 14:69355930-69355952 GATGTCTCCCAGCACTGCATGGG + Exonic
1120403856 14:84069529-84069551 CATGTTTCCCAGGACTGGCTAGG + Intergenic
1121834576 14:97080268-97080290 AATGTTTGCCATCCCTGCCATGG - Intergenic
1122258415 14:100497903-100497925 CATGTCTCCCAGCCCTCACAGGG - Intronic
1122815577 14:104310523-104310545 CCTACATCCCAGCACTGCCAAGG - Intergenic
1123917900 15:25050695-25050717 TATGTTTCCGAACACTGCAAAGG - Intergenic
1124682593 15:31747883-31747905 GATTTTTGCCAGCAGTGCCACGG - Intronic
1127899619 15:63331284-63331306 CCTGTTTCCCAGCAGAGCCTCGG + Intronic
1129372535 15:75106455-75106477 CATGTTTACCAGGAGTACCAGGG + Intronic
1130578822 15:85116850-85116872 CCTATCTCCCAGCACAGCCAAGG + Intronic
1132481387 16:167850-167872 CCTGTTGCCCTGCACTGCCTGGG + Intergenic
1132858388 16:2057782-2057804 CATCTCTCCCAGCCCTGCCTCGG + Intronic
1132858397 16:2057811-2057833 CATCTCTCCCAGCCCTGCCTCGG + Intronic
1132858406 16:2057840-2057862 CATCTCTCCCAGCCCTGCCTCGG + Intronic
1132858415 16:2057869-2057891 CATCTCTCCCAGCCCTGCCTCGG + Intronic
1132858424 16:2057898-2057920 CATCTCTCCCAGCCCTGCCTCGG + Intronic
1132858433 16:2057927-2057949 CATCTCTCCCAGCCCTGCCTCGG + Intronic
1132858442 16:2057956-2057978 CATCTCTCCCAGCCCTGCCTCGG + Intronic
1132858451 16:2057985-2058007 CATCTCTCCCAGCCCTGCCTCGG + Intronic
1132858460 16:2058014-2058036 CATCTCTCCCAGCCCTGCCTCGG + Intronic
1133508151 16:6432266-6432288 CATGTTTCTGAGCACTTTCAGGG - Intronic
1134046645 16:11105891-11105913 CATGTCTCCCAGCACACTCAGGG - Intronic
1134263890 16:12676161-12676183 CCTGTGGCCCAGGACTGCCAGGG + Intronic
1135021376 16:18965927-18965949 GAAGTTTCCCAGCAGTCCCAGGG - Intergenic
1136626528 16:31465244-31465266 CATCACCCCCAGCACTGCCAGGG + Intronic
1137406371 16:48192667-48192689 AATGTTGCCCAGGTCTGCCATGG + Exonic
1138852912 16:60651618-60651640 CATGGTTCCCATCACTTCTAAGG + Intergenic
1139526196 16:67518356-67518378 CACGTTGGCCAGCACTCCCACGG + Intergenic
1139751125 16:69109448-69109470 GATGCCACCCAGCACTGCCAGGG - Exonic
1143097272 17:4484964-4484986 CATGTCTCCCAGAACTGGGAGGG - Intronic
1144564915 17:16352498-16352520 CATTGTTCCAGGCACTGCCAGGG - Intronic
1144814941 17:18027448-18027470 CATGGTCCCCAGCACTGACTGGG - Intronic
1148469077 17:47882431-47882453 CCGGTTTCCCACCCCTGCCAAGG - Intergenic
1153277854 18:3385454-3385476 CATGGTGCCCTGCTCTGCCAGGG + Intergenic
1156571190 18:38255293-38255315 GATGTTTCCTATCACTTCCAAGG + Intergenic
1156600411 18:38598908-38598930 TCTGTGTCCCAGCCCTGCCAGGG - Intergenic
1156917938 18:42483794-42483816 CATGTTTGCAAGCACAGGCATGG + Intergenic
1158547032 18:58405392-58405414 CCTGTTTCCATGCAGTGCCAGGG + Intergenic
1160477874 18:79209003-79209025 CATGCCTCTCAGCAATGCCAAGG - Intronic
1160830363 19:1101870-1101892 CCTGTCACCCGGCACTGCCAGGG + Intergenic
1161261776 19:3341762-3341784 CATGTTGCCCTGCACGGCCTGGG + Intergenic
1163251352 19:16128098-16128120 CATGTCTCCCAGCAGGGCCCGGG - Intronic
1165202057 19:34153223-34153245 CATGATTCCCAATACTGTCATGG + Intergenic
1202698496 1_KI270712v1_random:144005-144027 CTTGTTGCCCAGGAGTGCCATGG + Intergenic
925066077 2:929600-929622 CCTGTTCCCCAGCTCTGGCAAGG + Intergenic
926062663 2:9813880-9813902 TAAGTGCCCCAGCACTGCCATGG + Intergenic
927200325 2:20574458-20574480 CCTTTTTCCCACCACTGCGAAGG + Intronic
927895346 2:26778183-26778205 GATGTTGCCCAGCAGTGCCACGG - Exonic
928762848 2:34604947-34604969 CATATTTCTGAGCTCTGCCAAGG + Intergenic
931979597 2:67680232-67680254 TAGGTTTCACAGCTCTGCCATGG - Intergenic
933188202 2:79302292-79302314 GATGCTTCCCAGTATTGCCAAGG - Intronic
934046728 2:88178774-88178796 GCTGTTTCCCTCCACTGCCAGGG - Exonic
934279743 2:91601786-91601808 CTTGTTGCCCAGGAGTGCCATGG + Intergenic
936518720 2:113198728-113198750 CCTTTGCCCCAGCACTGCCAAGG + Exonic
937402638 2:121598168-121598190 CATGTTGAACAGCACCGCCATGG + Intronic
938102363 2:128505735-128505757 AATGTAATCCAGCACTGCCAAGG - Intergenic
940800590 2:158128601-158128623 CCTGTTTCCCAGCTCTGAGAAGG - Intronic
941314166 2:163971294-163971316 GAAGTTTCCCAGTAGTGCCAAGG + Intergenic
941791521 2:169557225-169557247 CATTGCTCCCAACACTGCCAGGG + Exonic
943419718 2:187655190-187655212 CATGTGTCCCAGCTCTGGCAGGG - Intergenic
947088146 2:226478642-226478664 TATGTTTTTCAGCACTGCCAAGG + Intergenic
947240348 2:227987723-227987745 CATCTTTCCCACCACTGCCCAGG - Intronic
947826273 2:233107869-233107891 CCTCTTCCCCAGCGCTGCCACGG + Intronic
948468960 2:238165347-238165369 CCTGTTTCCCATCAGAGCCAGGG + Intronic
948502726 2:238406895-238406917 AATGCTTCCCAGAACTGTCAGGG - Intergenic
948530466 2:238600451-238600473 CATGTTCCCCAGCAAGGCCTGGG - Intergenic
948857393 2:240736418-240736440 CAGGTGGCTCAGCACTGCCAGGG - Intronic
1169261443 20:4141497-4141519 GTTGTTTCACAGCACTGTCATGG - Intronic
1171086699 20:22244543-22244565 CATTCTTTCCGGCACTGCCATGG + Intergenic
1172129598 20:32646932-32646954 CATGTCTCCCAGCAAGACCATGG + Intergenic
1175033214 20:55975264-55975286 TGCGTTTCCCAGCACTGCCTTGG - Intergenic
1175498930 20:59435582-59435604 CATGTTTCCCAGCCTTTCTAGGG - Intergenic
1175572389 20:60033882-60033904 CATGTTTCTCACCACTGGCCTGG + Intronic
1176983414 21:15408767-15408789 CATGTTTCCCAGCACCCCATAGG - Intergenic
1177876372 21:26636830-26636852 CTTGCTCCCCAGCACTGCCCAGG + Intergenic
1178620044 21:34166469-34166491 CATACTTCCCAGCCCTGGCAGGG + Intergenic
1179180861 21:39043766-39043788 CATGTTCCCCAGCAAAGCCTGGG - Intergenic
1182065163 22:27425826-27425848 CATGTATCCAAGGATTGCCATGG - Intergenic
1184438741 22:44496304-44496326 GATGCCTCCCAGCCCTGCCAGGG - Exonic
1185045104 22:48524806-48524828 CACGTTTCCCAGCAGGGACAGGG - Intronic
1185411282 22:50684239-50684261 CATGTTTCCCATCTCAGCCAAGG - Intergenic
949474181 3:4426997-4427019 CATGTTTCCCACCTCTCCCTGGG + Intronic
950103140 3:10370461-10370483 CATGTTTGGCATCACCGCCAGGG + Intronic
950580226 3:13857261-13857283 CATGTTGCTGAGCTCTGCCAAGG + Intronic
952942617 3:38455288-38455310 CACGTTTCCCAGGACTGGCCAGG - Intronic
954937981 3:54344437-54344459 TATGGTTTCCAGCAGTGCCAAGG - Intronic
955173889 3:56592990-56593012 CTTGTTTCACAGCACTGAAAGGG - Exonic
955612834 3:60775779-60775801 CATGTGTCCCAGCCCCGGCATGG - Intronic
956086651 3:65618292-65618314 CATGTTTACAAGCATTGCAAAGG + Intronic
957574073 3:81986570-81986592 CATGTGTCCCAGCCCTGGCAGGG - Intergenic
960743819 3:120864198-120864220 CAAGTTTCACTTCACTGCCAAGG - Intergenic
961732187 3:128973799-128973821 CTTGCTCTCCAGCACTGCCATGG - Intronic
962847744 3:139286408-139286430 CACAGTTCCCGGCACTGCCATGG - Intronic
962848982 3:139293883-139293905 GATGTTTCCCTTCCCTGCCAAGG + Intronic
966292442 3:178375593-178375615 CATTTTTGCCAGTCCTGCCAAGG - Intergenic
966465150 3:180223635-180223657 ATTGTTTCCCTGAACTGCCATGG + Intergenic
966545232 3:181138759-181138781 CATGTTACCCAGCATGGCCAGGG - Intergenic
967267672 3:187705001-187705023 CATGCTTCCCAGCACCCCAAAGG + Intronic
970437697 4:16051418-16051440 AATGTTTCCCAGCACTCAAAAGG - Intronic
973373932 4:49275390-49275412 CGTTCTTCCCAGCACAGCCAAGG - Intergenic
973383480 4:49334849-49334871 CGTTCTTCCCAGCACAGCCAAGG + Intergenic
973387085 4:49519863-49519885 CGTTCTTCCCAGCACAGCCAAGG + Intergenic
973862246 4:55077422-55077444 CATGCCTCCCTGCACTGCCATGG + Intergenic
975920483 4:79380430-79380452 CTTATTGCCCAGCACAGCCAAGG + Intergenic
976344980 4:83989975-83989997 CACGTGTCCCAGCCCTGACAGGG - Intergenic
976841563 4:89438242-89438264 CCGCTTCCCCAGCACTGCCAAGG - Intergenic
977378292 4:96237259-96237281 CATGCTTCCCTGCACAGCCTCGG + Intergenic
978867943 4:113537734-113537756 CATGTTTCCAAGGACTGCTCAGG + Intronic
984135828 4:175937041-175937063 GATGTTTTCCAGCACTTTCAAGG + Intronic
984678308 4:182576675-182576697 CATGTTTATCTGCATTGCCAGGG + Intronic
986213378 5:5695040-5695062 CATGTGTCCCAGCCCTGGCAGGG - Intergenic
987159938 5:15132045-15132067 CATGCACCCCACCACTGCCATGG - Intergenic
987819494 5:22944344-22944366 CATGTGTCCCATATCTGCCAGGG - Intergenic
988539365 5:32095458-32095480 AATCTCTCACAGCACTGCCAAGG - Intronic
988900061 5:35722278-35722300 CATGCGTCCCAGCCCTGGCATGG + Intronic
989749625 5:44877412-44877434 CATGTTTCCCAGGACAGCTGTGG + Intergenic
991929389 5:71737420-71737442 AATGTTTCTCAGCTGTGCCATGG + Intergenic
993985600 5:94593627-94593649 CATTGTTCCCAACACTACCAGGG - Intronic
996176912 5:120369568-120369590 CATGGATCCCATGACTGCCAAGG - Intergenic
996847744 5:127919451-127919473 CATATTTTGCACCACTGCCATGG + Intergenic
996854304 5:127987749-127987771 CATGCTTCCCAGCTTTGTCAGGG + Intergenic
997634262 5:135393196-135393218 CATGATTCCCAGGGTTGCCATGG + Intronic
998798903 5:145848174-145848196 CATGTTTTCCACCCCTGCCATGG + Intergenic
1000961351 5:167605061-167605083 CATCTTTCACTGCACTGACAAGG - Intronic
1001668741 5:173456034-173456056 TTTGTCTCCCAGCAATGCCATGG + Intergenic
1001827603 5:174758410-174758432 CATGTTTCCCAGCACAATAAAGG + Intergenic
1001876153 5:175202946-175202968 CATGTTTTCCAGCCCTGCTCAGG + Intergenic
1003173376 6:3737421-3737443 CATGATTCCCTCCACTGCCCAGG - Intronic
1003598915 6:7500495-7500517 CATGTTCCACAGCAATGCCTGGG - Intergenic
1005664251 6:28034581-28034603 CTTGATTCTCAGCACTGCTAGGG - Intergenic
1007341664 6:41194552-41194574 CGCGTCTCCCAGCAATGCCAGGG - Exonic
1007751435 6:44074016-44074038 CACATTTCCCAGCATTTCCAAGG + Intergenic
1012278720 6:97303363-97303385 CAGGCTTCTCAGAACTGCCAAGG - Intergenic
1014155960 6:118110093-118110115 CCTGTTTCCCATCTATGCCATGG + Intronic
1014713020 6:124831326-124831348 CATGGTTCCCAACACTGCCTGGG + Intergenic
1015846919 6:137530554-137530576 CATGTTTCCAAGAACTGCCATGG - Intergenic
1016210954 6:141532397-141532419 CCTGTTTCCCATGCCTGCCAAGG - Intergenic
1017100526 6:150845908-150845930 CAAGTTGCCCAGCACTGTGAGGG - Intergenic
1018572765 6:165228163-165228185 CATATTTCCCACCCCTGCAAAGG + Intergenic
1021564034 7:21999242-21999264 CATTTTTCGCAGGAATGCCATGG - Intergenic
1022889529 7:34682235-34682257 CCTGTGTCACAGCACTGCCCTGG + Intronic
1023461708 7:40404897-40404919 CACTATTCCCAGCACTGCTAGGG - Intronic
1024636299 7:51293191-51293213 CATGTTTTACAAAACTGCCAGGG - Intronic
1027359669 7:77394907-77394929 CATGTTGGCCAGCTCTGCCTAGG - Intronic
1028001281 7:85501333-85501355 GACTTTTCCCAGCACAGCCAAGG - Intergenic
1030650136 7:112108897-112108919 CTTATTTCTGAGCACTGCCAGGG + Intronic
1033562280 7:142544192-142544214 CATCTCTCCCAGCCCTGCCTGGG - Intergenic
1033865618 7:145687375-145687397 CATGTGTCCCAGCCCTGGCAGGG - Intergenic
1034677904 7:152904801-152904823 CAGGTTTTCCTGCACTGCCCAGG - Intergenic
1035281802 7:157783276-157783298 CACGTGTCACAGCACCGCCAAGG - Intronic
1035544314 8:468014-468036 CTGGTTTGGCAGCACTGCCAGGG + Intronic
1037525229 8:19717999-19718021 CATGATGCCCAGCCCTGCGATGG - Intronic
1039240746 8:35553793-35553815 CCTGTTTCCCAGCTCTGCCTTGG - Intronic
1045691314 8:104762809-104762831 CATGTTTCCTGGCACTGCAGAGG + Intronic
1047994772 8:130323949-130323971 CATGGCTCCCAGAGCTGCCAGGG + Intronic
1048913296 8:139157496-139157518 CATTTTTGCAAGCACTGTCATGG - Intergenic
1055569301 9:77600450-77600472 CAAGTTTCCCACCTGTGCCAAGG - Intronic
1056581624 9:87890900-87890922 CATGCTCCCCCTCACTGCCAAGG + Intergenic
1058868151 9:109180322-109180344 AGTGTCTCACAGCACTGCCAAGG + Intronic
1058876314 9:109248128-109248150 GAGGTCTCCCAGCAATGCCAGGG - Intronic
1060529795 9:124341500-124341522 CCTGCTTCCCAGCTCTGTCAGGG - Intronic
1060536163 9:124389759-124389781 CCTGCTTCCCAGCTCTGTCAGGG + Intronic
1061959694 9:133981761-133981783 CGTGTTTCCAAGCATTTCCAAGG + Intronic
1062267993 9:135696125-135696147 CATGCTTCCCAGCAGACCCAGGG + Intronic
1062268025 9:135696239-135696261 CATGCTTCCCAGCAGACCCAGGG + Intronic
1062537480 9:137027340-137027362 CGGCTTTCCCAGCACTGCCTGGG - Intronic
1203551584 Un_KI270743v1:167656-167678 CGTTCTTCCCAGCACAGCCAAGG + Intergenic
1189152949 X:38726319-38726341 CATGCATCCCAGCCCTGGCAGGG - Intergenic
1193951969 X:87810637-87810659 CATGTTTCTTAGCATTGCCAAGG + Intergenic
1195726589 X:107923931-107923953 CATGTTTCCCTGCTCTGCACAGG + Intronic
1196099710 X:111834960-111834982 CATGTTCAGCAGCACTACCAGGG + Exonic
1196520666 X:116667568-116667590 CATGTGTCCCAGCTCCGGCAGGG + Intergenic
1198522128 X:137463582-137463604 CATGTTTACCAGTAATGGCATGG - Intergenic
1198531126 X:137550166-137550188 CATTTTTACCAGCACGTCCAGGG - Intergenic
1198817510 X:140608360-140608382 CTTGTTTCCCTGCACAGCCTTGG + Intergenic
1199190503 X:144964397-144964419 CATGTCTAACAGTACTGCCAAGG + Intergenic
1199566689 X:149223008-149223030 GATGTTCCCCTCCACTGCCAAGG - Intergenic
1201368349 Y:13234127-13234149 CATGGATCCCAGGCCTGCCAAGG + Intergenic