ID: 1077700483

View in Genome Browser
Species Human (GRCh38)
Location 11:4436925-4436947
Sequence TTCCAAACCTTTATATCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077700483_1077700486 19 Left 1077700483 11:4436925-4436947 CCTGGAGATATAAAGGTTTGGAA No data
Right 1077700486 11:4436967-4436989 GCTTTAAATGCAGATGGTGAAGG No data
1077700483_1077700485 13 Left 1077700483 11:4436925-4436947 CCTGGAGATATAAAGGTTTGGAA No data
Right 1077700485 11:4436961-4436983 TAAGAAGCTTTAAATGCAGATGG No data
1077700483_1077700487 20 Left 1077700483 11:4436925-4436947 CCTGGAGATATAAAGGTTTGGAA No data
Right 1077700487 11:4436968-4436990 CTTTAAATGCAGATGGTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077700483 Original CRISPR TTCCAAACCTTTATATCTCC AGG (reversed) Intergenic
No off target data available for this crispr