ID: 1077700484

View in Genome Browser
Species Human (GRCh38)
Location 11:4436953-4436975
Sequence ATTTAAAGCTTCTTAAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077700484_1077700486 -9 Left 1077700484 11:4436953-4436975 CCTGCTTTTAAGAAGCTTTAAAT No data
Right 1077700486 11:4436967-4436989 GCTTTAAATGCAGATGGTGAAGG No data
1077700484_1077700487 -8 Left 1077700484 11:4436953-4436975 CCTGCTTTTAAGAAGCTTTAAAT No data
Right 1077700487 11:4436968-4436990 CTTTAAATGCAGATGGTGAAGGG No data
1077700484_1077700488 4 Left 1077700484 11:4436953-4436975 CCTGCTTTTAAGAAGCTTTAAAT No data
Right 1077700488 11:4436980-4437002 ATGGTGAAGGGAAGACCTAGTGG No data
1077700484_1077700490 6 Left 1077700484 11:4436953-4436975 CCTGCTTTTAAGAAGCTTTAAAT No data
Right 1077700490 11:4436982-4437004 GGTGAAGGGAAGACCTAGTGGGG No data
1077700484_1077700489 5 Left 1077700484 11:4436953-4436975 CCTGCTTTTAAGAAGCTTTAAAT No data
Right 1077700489 11:4436981-4437003 TGGTGAAGGGAAGACCTAGTGGG No data
1077700484_1077700491 16 Left 1077700484 11:4436953-4436975 CCTGCTTTTAAGAAGCTTTAAAT No data
Right 1077700491 11:4436992-4437014 AGACCTAGTGGGGAATGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077700484 Original CRISPR ATTTAAAGCTTCTTAAAAGC AGG (reversed) Intergenic
No off target data available for this crispr