ID: 1077700487

View in Genome Browser
Species Human (GRCh38)
Location 11:4436968-4436990
Sequence CTTTAAATGCAGATGGTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077700483_1077700487 20 Left 1077700483 11:4436925-4436947 CCTGGAGATATAAAGGTTTGGAA No data
Right 1077700487 11:4436968-4436990 CTTTAAATGCAGATGGTGAAGGG No data
1077700484_1077700487 -8 Left 1077700484 11:4436953-4436975 CCTGCTTTTAAGAAGCTTTAAAT No data
Right 1077700487 11:4436968-4436990 CTTTAAATGCAGATGGTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077700487 Original CRISPR CTTTAAATGCAGATGGTGAA GGG Intergenic
No off target data available for this crispr