ID: 1077701552

View in Genome Browser
Species Human (GRCh38)
Location 11:4446715-4446737
Sequence GACCACATATTTTATTAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077701552_1077701556 8 Left 1077701552 11:4446715-4446737 CCAAACTAATAAAATATGTGGTC No data
Right 1077701556 11:4446746-4446768 TGTAGTGGATGAGGTGAGCAGGG No data
1077701552_1077701557 9 Left 1077701552 11:4446715-4446737 CCAAACTAATAAAATATGTGGTC No data
Right 1077701557 11:4446747-4446769 GTAGTGGATGAGGTGAGCAGGGG No data
1077701552_1077701558 22 Left 1077701552 11:4446715-4446737 CCAAACTAATAAAATATGTGGTC No data
Right 1077701558 11:4446760-4446782 TGAGCAGGGGTAGAAAACTAAGG No data
1077701552_1077701554 -1 Left 1077701552 11:4446715-4446737 CCAAACTAATAAAATATGTGGTC No data
Right 1077701554 11:4446737-4446759 CTGTCGCACTGTAGTGGATGAGG No data
1077701552_1077701555 7 Left 1077701552 11:4446715-4446737 CCAAACTAATAAAATATGTGGTC No data
Right 1077701555 11:4446745-4446767 CTGTAGTGGATGAGGTGAGCAGG No data
1077701552_1077701553 -7 Left 1077701552 11:4446715-4446737 CCAAACTAATAAAATATGTGGTC No data
Right 1077701553 11:4446731-4446753 TGTGGTCTGTCGCACTGTAGTGG No data
1077701552_1077701559 25 Left 1077701552 11:4446715-4446737 CCAAACTAATAAAATATGTGGTC No data
Right 1077701559 11:4446763-4446785 GCAGGGGTAGAAAACTAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077701552 Original CRISPR GACCACATATTTTATTAGTT TGG (reversed) Intergenic
No off target data available for this crispr