ID: 1077701555

View in Genome Browser
Species Human (GRCh38)
Location 11:4446745-4446767
Sequence CTGTAGTGGATGAGGTGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077701552_1077701555 7 Left 1077701552 11:4446715-4446737 CCAAACTAATAAAATATGTGGTC No data
Right 1077701555 11:4446745-4446767 CTGTAGTGGATGAGGTGAGCAGG No data
1077701550_1077701555 24 Left 1077701550 11:4446698-4446720 CCACAATTAATTTTGCACCAAAC No data
Right 1077701555 11:4446745-4446767 CTGTAGTGGATGAGGTGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077701555 Original CRISPR CTGTAGTGGATGAGGTGAGC AGG Intergenic
No off target data available for this crispr