ID: 1077713106

View in Genome Browser
Species Human (GRCh38)
Location 11:4555185-4555207
Sequence GGTCAGAGGAGACACTAAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077713102_1077713106 -2 Left 1077713102 11:4555164-4555186 CCGTTCTACAAGAGCTGGCAAGG No data
Right 1077713106 11:4555185-4555207 GGTCAGAGGAGACACTAAGCGGG No data
1077713099_1077713106 19 Left 1077713099 11:4555143-4555165 CCCTGAGAAGTCAAAAGGCTGCC No data
Right 1077713106 11:4555185-4555207 GGTCAGAGGAGACACTAAGCGGG No data
1077713100_1077713106 18 Left 1077713100 11:4555144-4555166 CCTGAGAAGTCAAAAGGCTGCCG No data
Right 1077713106 11:4555185-4555207 GGTCAGAGGAGACACTAAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077713106 Original CRISPR GGTCAGAGGAGACACTAAGC GGG Intergenic
No off target data available for this crispr