ID: 1077715216

View in Genome Browser
Species Human (GRCh38)
Location 11:4573874-4573896
Sequence ACATAGAGACTCAGAAGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 320}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077715216_1077715222 15 Left 1077715216 11:4573874-4573896 CCCACCCTTCTGAGTCTCTATGT 0: 1
1: 0
2: 1
3: 34
4: 320
Right 1077715222 11:4573912-4573934 CTATATAGTTGTGTACACTTAGG 0: 1
1: 0
2: 2
3: 17
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077715216 Original CRISPR ACATAGAGACTCAGAAGGGT GGG (reversed) Intronic
900097071 1:944128-944150 ACACAGAGGCTGGGAAGGGTCGG - Exonic
900273744 1:1809565-1809587 ACAGAAAGTCTCAGAAGGGCTGG - Intronic
900785405 1:4646598-4646620 CCACAAAGACCCAGAAGGGTTGG - Intergenic
901205450 1:7492347-7492369 GCATAGAGGCTCAGAAGAGCTGG + Intronic
902528095 1:17072334-17072356 GCTTAGGGACTCAGAAGGGAGGG + Intronic
903457520 1:23497983-23498005 AAATTGAGACTCAGAGAGGTTGG - Intergenic
904857617 1:33510942-33510964 ACACAGGGAATCAGCAGGGTGGG - Intergenic
905226489 1:36482458-36482480 AAATAGAGACCCAGACGGGGAGG + Intronic
905462322 1:38129817-38129839 CCATGGAGACTCAGAAAGCTGGG + Intergenic
906544687 1:46612817-46612839 ATATAGACACTCTGCAGGGTTGG - Intronic
906902332 1:49848641-49848663 CCCTTGAGACTCAGAAGGGTAGG + Intronic
909734978 1:78947348-78947370 ATATAGAGACACAGAAGAGAAGG + Intronic
911515488 1:98863402-98863424 TATTGGAGACTCAGAAGGGTGGG - Intergenic
911745284 1:101435097-101435119 ACCTAGAGAATCAGAAGGTCTGG - Intergenic
911748505 1:101468076-101468098 ACAGAGAGACACAGAAGAGAAGG - Intergenic
912068121 1:105772587-105772609 ACATGGAGACTCAGAAGAATGGG - Intergenic
916013860 1:160730929-160730951 TCTTAGCCACTCAGAAGGGTGGG - Intergenic
916355216 1:163898510-163898532 ATATAGAGACACAGAAAGATGGG - Intergenic
916804893 1:168249824-168249846 AAGTAGAGTCTCAGTAGGGTAGG + Exonic
919087572 1:192938669-192938691 GAATAAAGACTCAGAAGAGTGGG - Intergenic
919099003 1:193070566-193070588 AGACAGCCACTCAGAAGGGTGGG + Intronic
923060646 1:230469829-230469851 CAGTAGAGACTCAGAAGGGGCGG - Intergenic
923697157 1:236264536-236264558 CACTGGAGACTCAGAAGGGTGGG + Intronic
924026213 1:239835549-239835571 AGATAGAGACTGATAAGGCTTGG + Intronic
924814812 1:247432259-247432281 CACTAGAGCCTCAGAAGGGTGGG - Intronic
1063686060 10:8238061-8238083 ACATTGAAACTCAGCAGGCTTGG - Intergenic
1063828704 10:9928160-9928182 TCCTAGCTACTCAGAAGGGTGGG + Intergenic
1064529460 10:16292811-16292833 AGAGAGAGACTGAGAAAGGTGGG - Intergenic
1067639494 10:48032262-48032284 ACATAAAGCCTCAGTAGAGTGGG + Intergenic
1067692498 10:48510912-48510934 ACATACAGCCTCGGAGGGGTTGG - Intronic
1069602566 10:69717294-69717316 AGGTTGAGACTCTGAAGGGTGGG + Intergenic
1069916041 10:71787546-71787568 CATTGGAGACTCAGAAGGGTGGG - Intronic
1070128017 10:73637530-73637552 TCATAGAGCCACTGAAGGGTTGG - Intronic
1070797654 10:79226210-79226232 AAATAGAGGCTCTGAGGGGTGGG + Intronic
1071747760 10:88441262-88441284 AGATAGAAACTCAGAAGAATAGG - Intronic
1072590443 10:96824061-96824083 ATATAAAGACTCAGGAGGCTGGG + Intergenic
1073027752 10:100500609-100500631 ACATTTAGACTCACAAGGCTGGG - Intronic
1074580526 10:114714668-114714690 ATACATACACTCAGAAGGGTTGG + Intergenic
1075984316 10:126770406-126770428 GCATAGAGACTGAGAGGTGTTGG - Intergenic
1075987655 10:126801406-126801428 CACTGGAGACTCAGAAGGGTGGG - Intergenic
1077715216 11:4573874-4573896 ACATAGAGACTCAGAAGGGTGGG - Intronic
1078446695 11:11410042-11410064 CCAGAGAGACAAAGAAGGGTGGG - Intronic
1079342631 11:19625224-19625246 TACTAGAGACTAAGAAGGGTTGG - Intronic
1079734796 11:23983457-23983479 CAATGGAGACTCAGAAGGGTGGG + Intergenic
1079774785 11:24511140-24511162 ACATAAACAGTCAGAAGGGAAGG - Intronic
1079799978 11:24856921-24856943 CAGTAGAGACTCAGAAGGGTGGG + Intronic
1080498989 11:32850252-32850274 ACATAGTGACGCAGAAAAGTTGG - Intronic
1080609290 11:33890126-33890148 CACTGGAGACTCAGAAGGGTGGG + Intronic
1082915668 11:58433879-58433901 CAATGCAGACTCAGAAGGGTAGG + Intergenic
1083270630 11:61570528-61570550 AAACTGAGACTCAGGAGGGTTGG + Intronic
1084000636 11:66293629-66293651 CCATAGGGACTCAGAAGTCTCGG - Intronic
1087027660 11:93666167-93666189 TCAGTGATACTCAGAAGGGTGGG - Intronic
1087491592 11:98834242-98834264 ATACAGAGACTCAGAACTGTTGG + Intergenic
1087577947 11:100013170-100013192 CAATGGAGACTCAGAAGTGTGGG + Intronic
1088056402 11:105585184-105585206 TACTAGAGACTGAGAAGGGTAGG - Intergenic
1088554128 11:111044334-111044356 CAAAGGAGACTCAGAAGGGTGGG - Intergenic
1089327635 11:117668239-117668261 AAACTGAGACTCAGAAAGGTTGG + Intronic
1091198677 11:133753530-133753552 ACATAGAGAATCTGAATGGATGG - Intergenic
1091446675 12:547657-547679 ACACAGAGGCACAGAAGGCTTGG - Intronic
1092095641 12:5839803-5839825 ACACTGAGACTCAGAGGGGCTGG + Intronic
1092502006 12:9057344-9057366 TACTGGAGACTCAGAAGGGTGGG + Intergenic
1092578058 12:9811805-9811827 ACATACATACTGAGCAGGGTTGG + Intergenic
1093525069 12:20095991-20096013 CACTGGAGACTCAGAAGGGTGGG + Intergenic
1096025583 12:48358283-48358305 CAATGGAGGCTCAGAAGGGTAGG - Intergenic
1096298596 12:50405673-50405695 AACTAGAGACTGGGAAGGGTGGG + Intronic
1096459095 12:51812169-51812191 ACATAGAGGCTAAGTGGGGTGGG + Exonic
1097649949 12:62285256-62285278 CATTGGAGACTCAGAAGGGTGGG - Intronic
1098468702 12:70819723-70819745 ATACAGAGACTCAGAAAGGGAGG + Intronic
1099112512 12:78579587-78579609 CACTGGAGACTCAGAAGGGTAGG + Intergenic
1099751593 12:86780815-86780837 CATTGGAGACTCAGAAGGGTAGG - Intronic
1100722514 12:97373864-97373886 GCAAAGAGACTGAGGAGGGTAGG + Intergenic
1101603141 12:106227634-106227656 TCATGGAAACTCAGAAGGCTAGG - Intergenic
1101898792 12:108775714-108775736 CCTCAGACACTCAGAAGGGTGGG + Intergenic
1102905587 12:116672425-116672447 CATTGGAGACTCAGAAGGGTGGG - Intergenic
1103139261 12:118534591-118534613 ACATTGAGGCACAGAGGGGTGGG + Intergenic
1103401550 12:120646628-120646650 TCATAGATACTCAGGAGGCTAGG - Intronic
1104417617 12:128608249-128608271 ACAAACAGCCTCACAAGGGTTGG + Intronic
1105669611 13:22597960-22597982 CAGTAGACACTCAGAAGGGTGGG + Intergenic
1107248683 13:38330039-38330061 CACTGGAGACTCAGAAGGGTGGG - Intergenic
1108181526 13:47844932-47844954 AAAAAGAGACTCGTAAGGGTGGG - Intergenic
1108564290 13:51679885-51679907 ACATAGAGACATAGAAAGGAAGG - Intronic
1108704082 13:52969313-52969335 ACATAGAAATTCAGAACGGTAGG + Intergenic
1108800203 13:54085668-54085690 CAATAAAGACTCAGAAAGGTGGG - Intergenic
1109419957 13:62099286-62099308 CATTAGAGACTCAGAATGGTGGG - Intergenic
1110629317 13:77688774-77688796 AAGTAGAGACTCAGAAGAGTAGG + Intergenic
1111349017 13:87001135-87001157 ACATTGGGACTCGGATGGGTGGG + Intergenic
1112563043 13:100530697-100530719 ACATAGAGACACAGCAGGAAAGG - Exonic
1114683686 14:24507759-24507781 ACACAGAGACAGAGGAGGGTGGG - Intronic
1114877725 14:26742559-26742581 ACATATAGAATCAGAAGAGGTGG - Intergenic
1115174371 14:30545886-30545908 ACATTGACAATCAAAAGGGTTGG - Intergenic
1115367239 14:32572005-32572027 AAATAGTGAATGAGAAGGGTAGG + Intronic
1115547778 14:34478547-34478569 ATTTAGAGACTCAGAAGTGGGGG + Intergenic
1116422462 14:44748791-44748813 TACTAGAGACTAAGAAGGGTGGG + Intergenic
1117555861 14:56883086-56883108 CAATGGAGACTCAGAAAGGTCGG + Intergenic
1117809653 14:59533116-59533138 ACAGAGAGACTCACACAGGTGGG + Intronic
1118515450 14:66523536-66523558 ACACAGATACTCAGAATAGTAGG + Intronic
1118843236 14:69527989-69528011 ACATGGGGAGCCAGAAGGGTTGG + Intronic
1120269993 14:82299525-82299547 AAATACAGACTCAGAGGGATAGG - Intergenic
1120926907 14:89806563-89806585 TCTTAGTGACTCAGAAGTGTAGG - Intronic
1121035940 14:90703726-90703748 ACATAGAAACTCAACAGGGAAGG + Intronic
1121086025 14:91146699-91146721 ACATGGAAACTCAGAATGGAAGG + Intronic
1121734537 14:96208827-96208849 TCAGAGAGGCTCAGAGGGGTTGG - Intronic
1122086650 14:99312302-99312324 AGACAGACACTCAGAAAGGTCGG - Intergenic
1122236297 14:100332411-100332433 ACAGAGAGACTGAGCTGGGTTGG + Intergenic
1123693846 15:22862547-22862569 AAATAAAAACTCAGAAGGGCTGG - Intronic
1126098876 15:45107906-45107928 AAAGAGAGACCCAGAGGGGTTGG + Intronic
1128817747 15:70626523-70626545 CACTGGAGACTCAGAAGGGTGGG + Intergenic
1128884607 15:71275104-71275126 GAATAGAGACTCACAGGGGTAGG + Intronic
1129426194 15:75464845-75464867 ACATGAAGACTGATAAGGGTGGG + Exonic
1129678534 15:77645169-77645191 ACATACACACTCAGAACGGGCGG + Intronic
1129952640 15:79605657-79605679 ACAAAGAGACTGAGAATGGCTGG + Intergenic
1131406068 15:92166015-92166037 ACGTAGAGACAAAGAAGGTTTGG + Intronic
1131625521 15:94115621-94115643 CCTTGGAGACTCAGAAAGGTGGG + Intergenic
1133496603 16:6324152-6324174 CTATGGAGACTCAGAAGGGTGGG - Intronic
1133583341 16:7167409-7167431 ACACAGAGACTCAGAGGAGAAGG + Intronic
1133961244 16:10495439-10495461 ACATAGAGAAAAAGAAGGCTCGG - Intergenic
1134262413 16:12662540-12662562 CATTGGAGACTCAGAAGGGTGGG - Exonic
1135045087 16:19148801-19148823 AGATTGTGACTCAGAAGGCTTGG + Intronic
1135876589 16:26206182-26206204 ACAGGGTGACTCAGAAGGATGGG + Intergenic
1135947529 16:26877938-26877960 ACATTGAGGCTCAGAAAGGCAGG + Intergenic
1138719675 16:59064885-59064907 CACTGGAGACTCAGAAGGGTGGG - Intergenic
1139269499 16:65668730-65668752 CATTGGAGACTCAGAAGGGTGGG - Intergenic
1140895190 16:79318418-79318440 GGATGGAGAATCAGAAGGGTGGG - Intergenic
1143541271 17:7570831-7570853 ACATGGAGACTCCCAGGGGTAGG - Intronic
1143661926 17:8330541-8330563 ACTTTGAGAATCAGCAGGGTAGG + Intergenic
1143852775 17:9825160-9825182 ACATTGAGGCTCAGAGAGGTTGG - Intronic
1144310414 17:14008853-14008875 AAGTAGAGACTTACAAGGGTAGG + Intergenic
1144424694 17:15130998-15131020 ACATAGGGAGTCAGAAAGGCAGG + Intergenic
1144994046 17:19254679-19254701 ACCTCAAGACTAAGAAGGGTGGG - Intronic
1145198035 17:20912993-20913015 ACATGGAGACTTGGAAGGGTTGG - Intergenic
1145272242 17:21411019-21411041 ACATAGGGACTCGGAGGGGGAGG - Intronic
1145310447 17:21698484-21698506 ACATAGGGACTCGGAGGGGGAGG - Intronic
1145994343 17:29096941-29096963 ACAGAGAGACCCAGAAGCATAGG + Intronic
1148436252 17:47688255-47688277 AAATCGAGAATCAGAAGAGTTGG - Intergenic
1149174252 17:53850598-53850620 ACATAGAAACTGGGAAGGTTTGG + Intergenic
1149640017 17:58196738-58196760 TCATAGAGTCTCAAAAGGTTAGG - Intronic
1149982740 17:61324160-61324182 ATACAGAGAATCAGAAGGATGGG - Intronic
1150252338 17:63713740-63713762 CCATAGTGAGTCAGAAAGGTTGG - Intronic
1152476346 17:80520953-80520975 ACATTGAGGCTCAGAGAGGTTGG + Intergenic
1154473491 18:14726870-14726892 ACACAGAGACCTAGGAGGGTGGG - Intergenic
1155947469 18:31872123-31872145 ACATTGAGACTTGGGAGGGTAGG - Intronic
1156077082 18:33292406-33292428 AACTAGAGACTAGGAAGGGTAGG + Intronic
1157450611 18:47784363-47784385 ACTTAGAGTCTCAGATGGGGAGG - Intergenic
1158268218 18:55683547-55683569 ACAAAGAGAGTCAGAAGGGCAGG - Intergenic
1159005152 18:63004553-63004575 ACACAAAGACTCTCAAGGGTGGG - Intergenic
1159621761 18:70647232-70647254 ACATATAAACTCACAGGGGTAGG + Intronic
1160217726 18:76947698-76947720 ACATACAGATTCAGAAGGGATGG + Intronic
1160688000 19:446097-446119 AGACAGAGACACAGAAGGGAGGG + Intronic
1164924552 19:32119382-32119404 AAACAGAGACTCAGAAGGACAGG + Intergenic
1165874013 19:38992963-38992985 ACACAGGGACTCACCAGGGTAGG + Intronic
1166254347 19:41591931-41591953 GGATAGAGACGCAGAAGTGTGGG - Intronic
1167740402 19:51321762-51321784 ACTCACAGACTCAGATGGGTAGG - Intronic
925579809 2:5398827-5398849 ACAAAGAGGCTCTGAAAGGTGGG - Intergenic
927120141 2:19952172-19952194 CATTGGAGACTCAGAAGGGTGGG - Intronic
928460009 2:31463404-31463426 GGATTGAGACTCAGAAGGATGGG - Intergenic
928478084 2:31651952-31651974 AAACTGTGACTCAGAAGGGTGGG - Intergenic
928536692 2:32247994-32248016 ACATGGAGACTTGGAAAGGTGGG + Intronic
931088583 2:58862003-58862025 CCATAGAGTCTCAGAAGGCCTGG - Intergenic
932221861 2:70005900-70005922 ACATAGAGACTCAGGAGCCATGG + Intergenic
933003247 2:76954107-76954129 CCATAAAGACTCAGAGAGGTAGG + Intronic
935171403 2:100613615-100613637 GCACAGAGAGGCAGAAGGGTGGG - Intergenic
937311393 2:120905462-120905484 AAATGGAGACTCAGAGAGGTTGG + Intronic
938222583 2:129582895-129582917 CATTGGAGACTCAGAAGGGTGGG - Intergenic
939480114 2:142737685-142737707 CTTTAGAGACTCAGAAGGGGAGG - Intergenic
939867084 2:147484612-147484634 ACATAGAACCTCAGACAGGTGGG - Intergenic
940190451 2:151035304-151035326 CATTAAAGACTCAGAAGGGTTGG + Intronic
940741024 2:157507754-157507776 CACTGGAGACTCAGAAGGGTGGG + Intergenic
941034497 2:160553421-160553443 AAATGGAGACTCTGAAGGGCTGG + Intergenic
942575358 2:177357366-177357388 CAATGGAGACTCAGAAGGGTGGG + Intronic
942980871 2:182079872-182079894 ACACAGAGACACAGAAGAGCAGG - Intronic
943194082 2:184719921-184719943 ACATTGATATTCAGAAGAGTGGG - Intronic
943213794 2:185004460-185004482 CAATGGAGACTCAGAAGGGTGGG + Intergenic
944406124 2:199385592-199385614 AAATGGAGATTCAGAAGGGATGG + Intronic
945112220 2:206370815-206370837 ACATAGAAACACAGATAGGTTGG - Intergenic
946067693 2:217003344-217003366 ACATAAAGTCTCACAAGGGGAGG + Intergenic
946809020 2:223503318-223503340 ACATAGAGTTTCAGTAGGGAAGG - Intergenic
947406244 2:229780552-229780574 TCAGAGAGACTGAGCAGGGTGGG - Intronic
947897848 2:233692144-233692166 ACATAAAAACTCAGAAGGGCAGG + Intronic
1169694211 20:8369184-8369206 ACACTGAGACTCAGAAGTTTGGG - Intronic
1170125903 20:12963876-12963898 AATTAGAGAATCAGAAGGGGTGG - Intergenic
1170981989 20:21222739-21222761 ACACAGAGACACAGAAGAGAAGG - Intronic
1172298165 20:33828564-33828586 ACACAGAGAGTCAGAAATGTAGG - Intronic
1173540291 20:43845996-43846018 AAAAAGAGACTCAGAAGGAGAGG + Intergenic
1173694582 20:44997899-44997921 ACATAGACCCTGTGAAGGGTGGG + Intronic
1173833187 20:46106402-46106424 AAATTGAGGCTCAGAAGAGTAGG + Intergenic
1175063746 20:56267565-56267587 ACCAAGAGTCTCAGAAGGTTTGG + Intergenic
1175478222 20:59292080-59292102 AAACCGAGACTCAGAAGGGGAGG - Intergenic
1176800991 21:13430995-13431017 ACACAGAGACCTAGGAGGGTGGG + Intergenic
1177112190 21:17042021-17042043 GCATGGAGGCTCAGAAGGATTGG + Intergenic
1178131299 21:29575301-29575323 CATTGGAGACTCAGAAGGGTGGG + Intronic
1178188168 21:30248832-30248854 ACATAGAGACACTGAATTGTGGG + Intergenic
1181028714 22:20139957-20139979 AGATTGAGCCTCAGAAGGCTTGG + Intronic
1181495001 22:23282775-23282797 GCACTGAGAGTCAGAAGGGTTGG - Intronic
1182248496 22:28980201-28980223 CATTGGAGACTCAGAAGGGTGGG + Intronic
1182886161 22:33775862-33775884 AAAAAAAGACTCAGGAGGGTGGG + Intronic
1183027932 22:35080121-35080143 ACAAAGAGACCGAGAAGGGGAGG - Intronic
1183057071 22:35313578-35313600 AAACAGAGACTCAGAGGGGCTGG + Intronic
1183191793 22:36326340-36326362 CCATAGCAACTCAGAAGGCTAGG + Intronic
949129607 3:483931-483953 ACATCGAGACTTAGAGAGGTGGG + Intergenic
950001896 3:9663174-9663196 ACAGAGAGCCTCAGAGGGGAAGG + Intronic
950199376 3:11032293-11032315 CACTGGAGACTCAGAAGGGTGGG - Intronic
951365566 3:21777835-21777857 ACCAAGAGACTCAGCAGGGTAGG - Intronic
951532940 3:23714641-23714663 ACAAAGAGAATGAGAAGAGTTGG + Intergenic
952183972 3:30948327-30948349 CACTGGAGACTCAGAAGGGTGGG + Intergenic
953345620 3:42172857-42172879 TCATAGAGACTGAGCACGGTGGG + Intronic
954960033 3:54556315-54556337 ACAGAGACACACAGAAGGGAAGG + Intronic
955061151 3:55492352-55492374 AAATTGAGGCTCAAAAGGGTAGG - Intergenic
956653739 3:71529670-71529692 CCATAGAAACTCAGAAGGATGGG + Intronic
957231559 3:77523904-77523926 CCAAAGAGATTCAGAAGGTTAGG + Intronic
957314289 3:78557601-78557623 AGATAGTGACTTAGAAGGCTGGG - Intergenic
957521600 3:81325548-81325570 TATTGGAGACTCAGAAGGGTGGG - Intergenic
959010975 3:101075954-101075976 ACATAGAGAGTTGGACGGGTGGG + Intergenic
961496798 3:127298955-127298977 CCCCAGAGACTCAGAAAGGTGGG + Intergenic
962889824 3:139661984-139662006 TCATGGTGACTCAGAATGGTAGG + Intronic
963178495 3:142327841-142327863 TAATAGAGACTTGGAAGGGTGGG - Intronic
964669559 3:159209872-159209894 ACTCTGAGATTCAGAAGGGTTGG + Intronic
964742288 3:159979211-159979233 AATTAGAGCTTCAGAAGGGTAGG + Intergenic
965396298 3:168163920-168163942 GCATAGGGACACACAAGGGTAGG + Intergenic
965516311 3:169624987-169625009 GCTCAGAAACTCAGAAGGGTTGG - Intronic
965559545 3:170048249-170048271 CTATGGAGACTCAGAAGGGCAGG + Intronic
965642962 3:170850439-170850461 ACAGAGAGACTATAAAGGGTTGG - Intronic
966314558 3:178631368-178631390 ACATTGAGACTGAAAAGGCTAGG + Intronic
967472826 3:189882728-189882750 ACATAGATAGTCACTAGGGTTGG + Intronic
968397920 4:260759-260781 ACCTAGAGAAACAGGAGGGTCGG + Intergenic
969079479 4:4607299-4607321 ACATAAAGACTCAAAAGGTGTGG - Intergenic
970310216 4:14775040-14775062 CACTGGAGACTCAGAAGGGTGGG + Intergenic
970410910 4:15807103-15807125 GCGTAGAGACTCATGAGGGTGGG + Intronic
970959040 4:21851393-21851415 CACTAGAGACTAAGAAGGGTTGG + Intronic
972076159 4:35090208-35090230 AGATAGAGACACAGAAGAGTTGG - Intergenic
973788076 4:54352833-54352855 CAATGGAGACTCAGAAGGGTGGG - Intergenic
974310859 4:60208766-60208788 CAAGAGAGAGTCAGAAGGGTGGG + Intergenic
974642604 4:64650807-64650829 CAATGGAGACTCAGAAGGGTGGG + Intergenic
975059564 4:69980302-69980324 TACTAGAGACTTAGAAGGGTAGG - Intergenic
975448255 4:74493282-74493304 ACATACTGACTTAGAAGGGCTGG - Intergenic
976147220 4:82053714-82053736 AAATAGAGGGTCAGAAGGGAAGG + Intergenic
977170458 4:93755147-93755169 ACATAGACACATAGAAAGGTAGG + Intronic
977718349 4:100209378-100209400 GCATAAAAACTCAGAAGGGAGGG + Intergenic
977836634 4:101652911-101652933 ACATACATACTCAAAAGTGTGGG + Intronic
978677136 4:111332540-111332562 ACTTGGAGACTCAGATGAGTGGG + Intergenic
979344616 4:119572118-119572140 ACATGGAGTTTCAGAGGGGTAGG - Intronic
979742082 4:124163982-124164004 CCATGGGGACTCAGAAGGTTGGG + Intergenic
980279462 4:130700666-130700688 CATTGGAGACTCAGAAGGGTGGG - Intergenic
981225896 4:142294025-142294047 CACTGGAGACTCAGAAGGGTAGG + Intronic
983848394 4:172547419-172547441 ACAGAGAGTGGCAGAAGGGTTGG - Intronic
985208648 4:187568444-187568466 ACATAGAGAGAGAGAAGGGATGG - Intergenic
985329705 4:188817749-188817771 AAATAGAGACTCAGAAGCAAAGG + Intergenic
986553960 5:8991431-8991453 GCATAGAGTCTCAGAATGGTGGG + Intergenic
987690753 5:21263318-21263340 ACATAAAAACTCAGTAGGCTGGG - Intergenic
988222329 5:28364239-28364261 CGATGGAGACTCAGAAGGGTAGG + Intergenic
989297283 5:39844363-39844385 CAATAGAGACTGTGAAGGGTAGG - Intergenic
989309493 5:39998164-39998186 ACACTGAGACCCAGAAAGGTGGG + Intergenic
991254330 5:64597733-64597755 CATCAGAGACTCAGAAGGGTGGG + Intronic
992276386 5:75124801-75124823 CACTGGAGACTCAGAAGGGTAGG + Intronic
992404953 5:76448047-76448069 CCAGAGAGACTCAGAAAGGCTGG + Intronic
993165062 5:84342399-84342421 CAATGGAGACTCAGAAAGGTGGG + Intronic
994553387 5:101264414-101264436 ACATGGAAACTCAGAAGCATAGG + Intergenic
996672980 5:126140929-126140951 GCAATGAGACTCAGAAGTGTAGG - Intergenic
996790189 5:127284245-127284267 ACATAGAGGATTAGAAAGGTGGG - Intergenic
998570459 5:143252221-143252243 ACATATATACTAAGAATGGTTGG + Intergenic
999138797 5:149343047-149343069 AAATTGAGGCTCAGAAAGGTTGG - Intergenic
1000003823 5:157165061-157165083 CATTGGAGACTCAGAAGGGTTGG + Intronic
1000024839 5:157349277-157349299 TTTTGGAGACTCAGAAGGGTGGG - Intronic
1000929855 5:167238104-167238126 AGATAATGATTCAGAAGGGTTGG + Intergenic
1001424604 5:171615103-171615125 ACAAAGAGCCTCAGGAGGGGTGG + Intergenic
1002383748 5:178850273-178850295 ACATACAGATTGAGCAGGGTTGG - Intergenic
1002688131 5:181031560-181031582 CATTGGAGACTCAGAAGGGTGGG + Intergenic
1003415232 6:5901458-5901480 CATTGGAGACTCAGAAGGGTAGG + Intergenic
1004139529 6:13003741-13003763 CACTAGAGACTCAGAAGGGTGGG - Intronic
1004623583 6:17353175-17353197 ACAAAGAGACTCAAAAGGTCGGG - Intergenic
1005475743 6:26205902-26205924 ACATACAGATTCAGTAGGTTTGG - Intergenic
1007286699 6:40753039-40753061 AAATTGAGACTTAGAAAGGTAGG - Intergenic
1008936175 6:56995057-56995079 AGATTGAGACTCACAAGGATAGG - Intronic
1009278338 6:61714879-61714901 CAATGGAGACTCAGAAGAGTGGG + Intronic
1009422665 6:63481202-63481224 ACCTTGAGACTCAGAAGGGGCGG + Intergenic
1010365914 6:75050809-75050831 ACATAGAGAAGCAGATGGTTGGG - Intergenic
1012012987 6:93815231-93815253 AAATAGGGACTCAGAAGGGTGGG + Intergenic
1012107690 6:95185424-95185446 ACAGAGACACTGAGGAGGGTGGG - Intergenic
1012367655 6:98461887-98461909 ACATAGAGATACAGAAGGTCAGG + Intergenic
1013674045 6:112437144-112437166 AGATAGAGACTCCAGAGGGTAGG + Intergenic
1014780578 6:125560079-125560101 ACAAAGAGACTCAGAGGGGAAGG + Intergenic
1014870164 6:126584902-126584924 CAATGGAAACTCAGAAGGGTGGG - Intergenic
1015216473 6:130755746-130755768 TCGTAGACACTAAGAAGGGTGGG - Intergenic
1017549768 6:155493457-155493479 AAAGGGAGACTCAGAGGGGTTGG + Intergenic
1018005190 6:159615389-159615411 CATTGGAGACTCAGAAGGGTAGG + Intergenic
1019258208 7:65022-65044 ACATACAGGCTCAGAGTGGTGGG - Intergenic
1019366352 7:635411-635433 CCACAGAGCCTCAGAAGGATCGG + Intronic
1020589602 7:10117956-10117978 CACTGGAGACTCAGAAGGGTGGG - Intergenic
1021528175 7:21612258-21612280 AAACAGAGACTAAGAAGGCTGGG + Intronic
1022154293 7:27643873-27643895 ACACAGAGACACAGAGGGGAAGG - Intronic
1022301441 7:29106148-29106170 ACAGAGAGACTCAGGAGGCTGGG + Intronic
1022534505 7:31087419-31087441 AGATAGAGGCTCAGAAGGAGGGG + Intronic
1023376192 7:39558156-39558178 TATTAGAGACTGAGAAGGGTAGG + Intergenic
1024331145 7:48156492-48156514 TGATAGAGACTGAGAAGGTTGGG + Intergenic
1025641071 7:63370059-63370081 AAATAAAGACACAGAAGTGTTGG + Intergenic
1026663136 7:72319835-72319857 CAATGGAGACTCAGAAAGGTAGG + Intronic
1027449414 7:78313177-78313199 TAATAGAGACTCAGAAAGGTGGG + Intronic
1028164296 7:87520277-87520299 AGAAACAGACTCAGAAAGGTTGG + Intronic
1031438940 7:121769048-121769070 CCCTGGAGACTCAAAAGGGTTGG + Intergenic
1033169093 7:139067541-139067563 CAATGGAGACTCAGAAGGATAGG + Intronic
1033865547 7:145686931-145686953 ACATAGGAACTCAAAAGGCTGGG - Intergenic
1034417237 7:150971569-150971591 AGATAGAGGCTCCGAGGGGTGGG + Intronic
1035403689 7:158585680-158585702 ACAGAGAAAGTCAGAAAGGTGGG - Intronic
1036581207 8:10077563-10077585 TCAGAGAGACTCAGGAGGGAGGG - Intronic
1037227303 8:16608201-16608223 ACATAAAGACTGAGAAAGATTGG + Intergenic
1037716664 8:21406832-21406854 ACATACATACAGAGAAGGGTGGG - Intergenic
1038103945 8:24412521-24412543 CATTGGAGACTCAGAAGGGTGGG + Intergenic
1038444837 8:27596142-27596164 ACAGAGGGGCTCAGCAGGGTTGG + Intergenic
1038891717 8:31732967-31732989 CAATAGAAACTCAGAAGGGTGGG - Intronic
1039101023 8:33942348-33942370 CACTGGAGACTCAGAAGGGTGGG + Intergenic
1039806332 8:41002858-41002880 ACGTTTAGACTCAGAAGAGTTGG - Intergenic
1040075518 8:43225224-43225246 CATTGGAGACTCAGAAGGGTGGG - Intergenic
1040552938 8:48452850-48452872 CCTTGGAGACTCAGAAGGGTTGG + Intergenic
1041660959 8:60400532-60400554 ACACAGAGACCCAGAAGGAGAGG + Intergenic
1042447432 8:68902729-68902751 TATTGGAGACTCAGAAGGGTGGG + Intergenic
1043389192 8:79775422-79775444 ACAAGGAGACTCAGAAGAGTAGG - Intergenic
1044126039 8:88458564-88458586 TCATTGAGATTCAGAAGGATGGG + Intergenic
1046679490 8:117152697-117152719 ACATAGAGACTAGAAAGTGTGGG - Intronic
1046730571 8:117721265-117721287 CATTGGAGACTCAGAAGGGTTGG - Intergenic
1048805570 8:138238063-138238085 AAACTGAGACCCAGAAGGGTAGG + Intronic
1049289134 8:141792261-141792283 ACACTGAGACTCAGATGGGTGGG + Intergenic
1052084456 9:24247470-24247492 ACTAAGAGACTCAGAAGGTAAGG + Intergenic
1055699881 9:78932358-78932380 CAAGAGAGACTAAGAAGGGTGGG + Intergenic
1056262231 9:84860462-84860484 AGATAGAGATTCAGGAGGGAGGG - Intronic
1059643902 9:116245142-116245164 ATATGGACACTCAGAAGGGTGGG + Intronic
1059691629 9:116690430-116690452 ACATAGGGGCTCTGAAGGGTTGG - Intronic
1059794389 9:117676124-117676146 ACATAATTAATCAGAAGGGTGGG + Intergenic
1060463063 9:123877030-123877052 CACTGGAGACTCAGAAGGGTGGG + Intronic
1061211077 9:129193832-129193854 ACACAGAGTCTCAGGAGGGAGGG + Intergenic
1061697511 9:132387974-132387996 AAACTGAGACTTAGAAGGGTAGG + Intronic
1061947937 9:133919322-133919344 AAATAGAGGCTCAGAAAGGCTGG + Intronic
1185724400 X:2407761-2407783 GACTGGAGACTCAGAAGGGTGGG + Intronic
1185799565 X:2997606-2997628 CACTGGAGACTCAGAAGGGTGGG - Intergenic
1185844333 X:3423403-3423425 CAATGAAGACTCAGAAGGGTGGG - Intergenic
1185914180 X:4017005-4017027 CACTGGAGACTCAGAAGGGTGGG - Intergenic
1185932277 X:4216461-4216483 CACTGGAGACTCAGAAGGGTGGG - Intergenic
1186134848 X:6508199-6508221 ACAGAGAGACAAAGAAGAGTAGG + Intergenic
1186284518 X:8029058-8029080 CACTGGAGACTCAGAAGGGTAGG - Intergenic
1186499783 X:10041967-10041989 AAAAAGAAAATCAGAAGGGTTGG - Intronic
1187401445 X:18963978-18964000 ACCTAGAGACACAGAAAGGGTGG - Intronic
1187855094 X:23629120-23629142 ACAAAGAGATTCAGAAAAGTTGG + Intergenic
1188246704 X:27843656-27843678 ACACAGACACACAGAAGGGAAGG - Intergenic
1188509363 X:30918387-30918409 GAAAAGAGACTCAGAAGAGTGGG - Intronic
1189232705 X:39464880-39464902 ACAGAGAGACAGAGAAGGGAAGG + Intergenic
1189397748 X:40638570-40638592 CCAATGAGATTCAGAAGGGTAGG + Intronic
1189449476 X:41114774-41114796 AAAAAGAAACTCAGAAGGGGTGG - Intronic
1189535320 X:41929036-41929058 CATTAGAGACTCAGAAGGGTGGG + Intergenic
1190910062 X:54762991-54763013 ACACTGAGACTCAGAGAGGTGGG + Intronic
1193211780 X:78815211-78815233 TAATAGAGACTGAGAAGGGTGGG + Intergenic
1193235283 X:79099327-79099349 AAATGAAGACTCAGAAGGGTGGG + Intergenic
1194386790 X:93265272-93265294 ATATATACACACAGAAGGGTGGG - Intergenic
1195842309 X:109187700-109187722 ACATTGAGCCTCAGAATGGGAGG - Intergenic
1196881741 X:120205125-120205147 ACATAGACACTCAGGATTGTTGG + Intergenic
1197953532 X:131922887-131922909 CCCTAGAGACTGCGAAGGGTTGG + Intergenic
1199422668 X:147662597-147662619 AGATGGAGACTTGGAAGGGTGGG - Intergenic
1199885129 X:152012929-152012951 AAACAGAGACTGGGAAGGGTGGG + Intergenic
1201376328 Y:13324496-13324518 AAATAAAGACTCAGAATGTTGGG + Intronic