ID: 1077715221

View in Genome Browser
Species Human (GRCh38)
Location 11:4573911-4573933
Sequence CTAAGTGTACACAACTATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 100}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077715221_1077715225 4 Left 1077715221 11:4573911-4573933 CCTATATAGTTGTGTACACTTAG 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1077715225 11:4573938-4573960 TACCCATCAACAAGGGTCTCAGG 0: 1
1: 0
2: 0
3: 4
4: 109
1077715221_1077715226 5 Left 1077715221 11:4573911-4573933 CCTATATAGTTGTGTACACTTAG 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1077715226 11:4573939-4573961 ACCCATCAACAAGGGTCTCAGGG 0: 1
1: 0
2: 0
3: 10
4: 81
1077715221_1077715224 -3 Left 1077715221 11:4573911-4573933 CCTATATAGTTGTGTACACTTAG 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1077715224 11:4573931-4573953 TAGGTTTTACCCATCAACAAGGG 0: 1
1: 0
2: 1
3: 7
4: 82
1077715221_1077715223 -4 Left 1077715221 11:4573911-4573933 CCTATATAGTTGTGTACACTTAG 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1077715223 11:4573930-4573952 TTAGGTTTTACCCATCAACAAGG 0: 1
1: 0
2: 0
3: 9
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077715221 Original CRISPR CTAAGTGTACACAACTATAT AGG (reversed) Intronic
903042984 1:20545630-20545652 TTAAGTGTACACAACAGTATTGG - Intergenic
907005996 1:50914311-50914333 ATAAGTATACAAAACTATATAGG + Intronic
907016098 1:51014581-51014603 ATAGGCGTACACCACTATATCGG - Intergenic
908606318 1:65800793-65800815 CTAAGACTATCCAACTATATGGG + Intronic
911853594 1:102850610-102850632 CCAAGTGGACATAACTATTTGGG + Intergenic
912758561 1:112345910-112345932 CCAAGGGTACACAACTAAAGAGG + Intergenic
1068266468 10:54656542-54656564 CTATGTGTACACAACTAGTACGG - Intronic
1068688768 10:59894949-59894971 CTAACTGAACAGAACTGTATAGG + Intronic
1071228722 10:83561838-83561860 CTAAGTGTACGCAAGAATAGTGG + Intergenic
1074128319 10:110549222-110549244 CTAAATGTATAAAACTATAAAGG - Intergenic
1077715221 11:4573911-4573933 CTAAGTGTACACAACTATATAGG - Intronic
1079059141 11:17232529-17232551 ACAAGTTTACATAACTATATTGG - Intronic
1080005303 11:27399895-27399917 CTATGTGTTCAGAACTATGTTGG + Intronic
1083047910 11:59753379-59753401 CAAAGTGTACACACATATATAGG - Intronic
1083654582 11:64223373-64223395 CGAATTGTACACGAGTATATCGG + Exonic
1085662468 11:78381753-78381775 CTATATGTACATAACTACATTGG - Intronic
1088287806 11:108206130-108206152 ATAACTGTACACAACAATATGGG + Intronic
1089344500 11:117782139-117782161 CTCAATGTCCACAACTTTATAGG + Intronic
1091191226 11:133697118-133697140 CTAAGTGTACTGAACTGTGTTGG + Intergenic
1093015707 12:14152534-14152556 CAAAGTGTAGAGCACTATATAGG + Intergenic
1093703616 12:22250348-22250370 CTAAGTGTACACATCAAGGTTGG - Intronic
1095043812 12:37476010-37476032 TTAATTTTACACAAATATATTGG + Intergenic
1098601260 12:72334409-72334431 TTAAGAGTCCACAACTAAATTGG + Intronic
1099059390 12:77887292-77887314 CAATTTCTACACAACTATATAGG + Intronic
1101977328 12:109371173-109371195 CTATGTGTACACACGTACATTGG + Intronic
1104072900 12:125361954-125361976 CTAAGTGTTCACTAAGATATTGG - Intronic
1106232520 13:27831907-27831929 CTAAGAGTTCACATTTATATAGG - Intergenic
1106723638 13:32462190-32462212 CTAAGTGTACATAAATGGATGGG + Intronic
1112171278 13:96974847-96974869 CTAAGTATACACAAATATCCTGG - Intergenic
1112674929 13:101690220-101690242 CTAACTTTACACAAAAATATGGG + Intronic
1113521051 13:110941270-110941292 CTCAGTGTTCACATCTGTATTGG + Intergenic
1118963578 14:70558580-70558602 ATAAGAGTACAGAACTATAGTGG + Intergenic
1202942346 14_KI270725v1_random:163644-163666 TTAATTTTACACAAATATATTGG + Intergenic
1126291074 15:47079861-47079883 TTAATTTTACACAAATATATTGG - Intergenic
1139313609 16:66048363-66048385 CTAAGTGGACAGTACGATATTGG + Intergenic
1140383569 16:74512963-74512985 CTAAGTGTACAAAAGTAGAAAGG + Intronic
1142648523 17:1330741-1330763 GTAAGTGAACACAATTGTATTGG + Intergenic
1142732057 17:1866282-1866304 CTAAGCATATACAAGTATATGGG - Intronic
1156767815 18:40679906-40679928 CTAAGTTTACACAGCTATCATGG - Intergenic
1157399372 18:47374313-47374335 CCAAGTGTACACACCTCTTTTGG - Intergenic
1160472453 18:79149085-79149107 TTAAGTGTACAAAACAATTTTGG - Intronic
1163378995 19:16951982-16952004 CTCAGTGTCTACAACTACATGGG - Exonic
1164366117 19:27583700-27583722 TTAAGTTTTCACCACTATATAGG - Intergenic
1167701498 19:51049962-51049984 CTAAGTGTTGACAAAGATATGGG - Intergenic
1168653484 19:58109607-58109629 CTAAGAGTACACAAAAATATGGG + Intronic
931863685 2:66386352-66386374 CAAAGAGTACAAAATTATATAGG + Intergenic
932686045 2:73871114-73871136 ATAAGTTTACACAAATATTTTGG + Intronic
938793967 2:134702965-134702987 CAAAGTGTACAGAACTCTAAGGG + Intronic
945335373 2:208586569-208586591 CTAATTGTAGTCAACTAGATAGG - Intronic
1170452481 20:16498437-16498459 GTAAGTTTACACAACCAAATTGG - Intronic
1171538273 20:25918736-25918758 TTAATTATACACAAATATATTGG + Intergenic
1171841220 20:30214042-30214064 TTAATTTTACACAAATATATTGG + Intergenic
1172770953 20:37382329-37382351 CTAAGGTTACACAGCTATTTAGG + Intronic
1174464682 20:50708091-50708113 CTAAGGTTACACAACTATGAAGG + Intergenic
1176580824 21:8523283-8523305 TTAATTTTACACAAATATATTGG - Intergenic
1178157591 21:29872916-29872938 CTAACTGGCCACAAATATATTGG - Intronic
1178969947 21:37164942-37164964 CTAAGAGCACAGAACTAAATAGG - Intronic
1179202019 21:39233444-39233466 CACAGTGTACACAAATAAATAGG + Intronic
1183223086 22:36529615-36529637 CTCAGTTTCCACAACTATAAAGG - Intergenic
1184635115 22:45821855-45821877 CCAAGTGTATACATATATATTGG - Intronic
1184935651 22:47718488-47718510 CCAGGTGTGCACAATTATATTGG - Intergenic
950091588 3:10299549-10299571 CTAAGTATAAACAACTATTATGG + Intronic
951011320 3:17683622-17683644 CTATGTGTACAAAACTGTAATGG + Intronic
957658436 3:83113519-83113541 CTAACTGTAAACAAGTAGATGGG + Intergenic
958137367 3:89513011-89513033 CTACATGTAAACAACTATTTTGG - Intergenic
962523385 3:136217298-136217320 TTATGTGTACAGAAATATATGGG + Intergenic
965453717 3:168871165-168871187 CCAATTATTCACAACTATATTGG - Intergenic
965868118 3:173230833-173230855 CTAAGTGTACATATTTATAAAGG - Intergenic
969118755 4:4891287-4891309 ATAAGTGCACACAACTGTTTTGG - Intergenic
970017812 4:11532301-11532323 CTCAGTGTTCTCAACAATATGGG - Intergenic
971826559 4:31630900-31630922 TCAAGAGTACACAACTAAATTGG + Intergenic
972812649 4:42607701-42607723 CTAAATGTACAAAATTACATTGG - Intronic
972815914 4:42645388-42645410 TAAATTGTATACAACTATATAGG - Intronic
972961413 4:44457351-44457373 TTAAGTGTTCACAGATATATTGG - Intergenic
975198880 4:71561395-71561417 CTAATTGTACACAGCCATAGTGG + Intronic
977071615 4:92396838-92396860 CTAGGTCAACACTACTATATTGG - Intronic
983712632 4:170738435-170738457 TTAACTGTACACTAATATATAGG + Intergenic
992841998 5:80704315-80704337 CTAAGTGTAGAAAACAATACTGG + Intronic
994341390 5:98632840-98632862 CTCAGTGTTCTCAACTATAAAGG + Intergenic
995313056 5:110735061-110735083 CTATGTGTAAACCACTGTATTGG - Intronic
995607957 5:113878660-113878682 CTAAGTCTACAGAAATATAAAGG - Intergenic
997851091 5:137333180-137333202 CTAAGTGTACAAAGCTGTGTAGG + Intronic
998679497 5:144450896-144450918 TTAAGTGTACAATACCATATTGG - Intronic
1005187371 6:23177931-23177953 CTAAGTGTACACACATGGATGGG - Intergenic
1010917004 6:81632527-81632549 CTAAGTGTACACAAGCAAACAGG + Intronic
1012553595 6:100486711-100486733 CTAAGTGAACACAATCATCTTGG + Intergenic
1012948193 6:105490054-105490076 CTGAATGTACACATCTACATAGG - Intergenic
1015088236 6:129322317-129322339 CTATGTGTACATATGTATATTGG - Intronic
1016820019 6:148338482-148338504 CCAAGTGAACACAGCTACATGGG - Intronic
1020601561 7:10280733-10280755 CTGAGTCTACAAATCTATATTGG - Intergenic
1021627624 7:22609847-22609869 CCAACTGCACACAACTATACAGG + Intronic
1025289730 7:57705569-57705591 TTAATTTTACACAAATATATTGG + Intergenic
1026083988 7:67247864-67247886 AAAAGTGTACACAACAATTTGGG - Intergenic
1026693044 7:72566163-72566185 AAAAGTGTACACAACAATTTGGG + Intronic
1028435213 7:90795368-90795390 GTAAGTAGACACAACTATACCGG - Intronic
1031456447 7:121986280-121986302 CCAAGTTTACACAACTAGAAAGG + Intronic
1036413145 8:8521083-8521105 CTAAGTGTCTACTATTATATGGG + Intergenic
1038204363 8:25451065-25451087 CCAAGTGAAAACAAGTATATTGG - Intronic
1043100739 8:76041783-76041805 CTAAGTGTCCACAACTAAAAAGG + Intergenic
1045767768 8:105695412-105695434 CTAAGTTTACAAAACAATTTCGG - Intronic
1047235387 8:123037502-123037524 CTAAGGGTACACAACTAGCAGGG + Intronic
1051176778 9:14368885-14368907 CTCAGTTTTCCCAACTATATAGG + Intronic
1054888888 9:70230551-70230573 GTATGTGTACACATGTATATAGG - Intergenic
1203610839 Un_KI270749v1:1375-1397 TTAATTTTACACAAATATATTGG - Intergenic
1186163812 X:6805659-6805681 ATAAGTGTGCACAACTACACGGG + Intergenic
1194150064 X:90313187-90313209 CTAATTGTACACAACTTTCTTGG - Intergenic
1198272758 X:135070151-135070173 CTATGTGTACATCACTATATTGG - Intergenic
1199736549 X:150691690-150691712 CTAAGTGTACTTAACTGAATTGG + Intergenic
1200496492 Y:3890265-3890287 CTAATTGTACACAACTTTCTTGG - Intergenic
1201890793 Y:18941758-18941780 CTCAGCCTACACACCTATATGGG + Intergenic