ID: 1077718113

View in Genome Browser
Species Human (GRCh38)
Location 11:4601183-4601205
Sequence TTATCTTAGTACAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 228}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077718103_1077718113 14 Left 1077718103 11:4601146-4601168 CCTCAGGGCCAGGAGTCCCGGCT 0: 1
1: 0
2: 3
3: 56
4: 648
Right 1077718113 11:4601183-4601205 TTATCTTAGTACAGGGAAGAGGG 0: 1
1: 0
2: 1
3: 13
4: 228
1077718107_1077718113 -2 Left 1077718107 11:4601162-4601184 CCCGGCTTTGTCACATGGGCCTT 0: 1
1: 0
2: 1
3: 16
4: 275
Right 1077718113 11:4601183-4601205 TTATCTTAGTACAGGGAAGAGGG 0: 1
1: 0
2: 1
3: 13
4: 228
1077718108_1077718113 -3 Left 1077718108 11:4601163-4601185 CCGGCTTTGTCACATGGGCCTTA 0: 1
1: 0
2: 2
3: 19
4: 256
Right 1077718113 11:4601183-4601205 TTATCTTAGTACAGGGAAGAGGG 0: 1
1: 0
2: 1
3: 13
4: 228
1077718104_1077718113 6 Left 1077718104 11:4601154-4601176 CCAGGAGTCCCGGCTTTGTCACA 0: 1
1: 0
2: 0
3: 7
4: 106
Right 1077718113 11:4601183-4601205 TTATCTTAGTACAGGGAAGAGGG 0: 1
1: 0
2: 1
3: 13
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077718113 Original CRISPR TTATCTTAGTACAGGGAAGA GGG Intronic
900012017 1:121913-121935 TTAGCTTTGTACTGGGAGGAGGG - Intergenic
900042077 1:477926-477948 TTAGCTTTGTACTGGGAGGAGGG - Intergenic
900063515 1:712872-712894 TTAGCTTTGTACTGGGAGGAGGG - Intergenic
901568310 1:10137547-10137569 TTTTCACAGTCCAGGGAAGAAGG - Intronic
903044430 1:20554362-20554384 TTTTTTTTGCACAGGGAAGAAGG - Exonic
903555825 1:24192662-24192684 TTATCTTAGTAGACAGGAGAGGG - Intergenic
904873746 1:33637585-33637607 TTATCTTAGAACAAGGAGGACGG - Intronic
905592960 1:39180713-39180735 CTACCTTAGTAAAAGGAAGAAGG - Intronic
905745995 1:40417820-40417842 TTATTTTGGAAGAGGGAAGAAGG - Intronic
908415073 1:63905109-63905131 TTGTCTTAGTGCAGAGAACATGG + Intronic
908664059 1:66469837-66469859 TTATCTTAGGAGAGAGAATATGG + Intergenic
909148939 1:71975681-71975703 TCAGCTCAGTACAGTGAAGAGGG - Intronic
909753056 1:79188659-79188681 TCATTTTACTACAGGGAGGAAGG + Intergenic
910247764 1:85160161-85160183 TTATCTTAGTGCAGGGAAATAGG - Intronic
912098716 1:106179248-106179270 TTATCTCAGCTGAGGGAAGAAGG - Intergenic
920012670 1:202880867-202880889 TTATATTAGCACAGACAAGAAGG + Exonic
921254987 1:213330984-213331006 TTATCCTGGTGCATGGAAGAAGG + Intergenic
921635742 1:217490115-217490137 TCATCTTTGTACATGAAAGATGG + Intronic
922260444 1:223938395-223938417 TTAGCTTTGTACTGGGAGGAGGG - Intergenic
922733229 1:227964536-227964558 TTAGCTTTGTACTGGGAGGAGGG + Intergenic
923760335 1:236836832-236836854 TCAGCTTAGTATTGGGAAGAGGG + Intronic
923908365 1:238411160-238411182 CTATTTTAGTTCAGTGAAGATGG + Intergenic
924341619 1:243040585-243040607 TTAGCTTTGTACTGGGAGGAGGG - Intergenic
1062823484 10:551593-551615 TTCTCTGAGCCCAGGGAAGATGG - Intronic
1063982423 10:11465080-11465102 TTATTTGCCTACAGGGAAGAAGG - Intronic
1064110120 10:12531354-12531376 TCATCTCAGGACAGGGCAGAAGG - Intronic
1065122191 10:22541166-22541188 TTATCTGACTCTAGGGAAGAGGG + Intronic
1066481236 10:35797547-35797569 TTATCTGAGTAAAGGGATGGAGG + Intergenic
1066734858 10:38464966-38464988 TTAGCTTTGTACTGGGAGGAGGG + Intergenic
1071432156 10:85614696-85614718 TTAGGTGAGGACAGGGAAGAAGG + Intronic
1072082861 10:92049752-92049774 TTATTTTAATACATGAAAGAGGG + Exonic
1072763267 10:98075794-98075816 TTATCTTTGGAGAGGGAAGTGGG + Intergenic
1073815002 10:107196820-107196842 TTATGTTATTTCAGGGAAGTTGG - Intergenic
1074468951 10:113709349-113709371 TTTTATTATTACAGAGAAGAAGG + Intronic
1074893065 10:117751325-117751347 CTAACATAGTACAGGGAAGATGG - Intergenic
1075533377 10:123249451-123249473 TGGTCTTAGTATAGGGAAGCTGG + Intergenic
1076299386 10:129413293-129413315 TCATCTCAGAAGAGGGAAGACGG + Intergenic
1076968348 11:114133-114155 TTAGCTTTGTACTGGGAGGAGGG - Intergenic
1077718113 11:4601183-4601205 TTATCTTAGTACAGGGAAGAGGG + Intronic
1078137409 11:8662804-8662826 TCATTTTAGGAAAGGGAAGAGGG - Intronic
1079994200 11:27278195-27278217 TTATCAAAGTACAGGAAATATGG - Intergenic
1080146584 11:28992741-28992763 TCATATTATCACAGGGAAGATGG - Intergenic
1080395593 11:31886916-31886938 TTCTTTTACTACAGGGAAGCTGG - Intronic
1080618000 11:33961737-33961759 TGATCTTAAGACAAGGAAGAGGG + Intergenic
1080780065 11:35420785-35420807 TTCTCTTAGCACAGAGAAGTGGG - Intergenic
1083970665 11:66072001-66072023 TTACCTTTGTAGAAGGAAGAGGG - Intronic
1084978810 11:72817635-72817657 TTAACTTCGTCCTGGGAAGATGG - Intronic
1087885252 11:103473223-103473245 TTATCTTAGTACATAGATAATGG - Intronic
1092086481 12:5767140-5767162 TTCTCTAAGTCCAGGGAGGAAGG - Intronic
1092669238 12:10843629-10843651 TTTTCTTAGTAGAAGGAATAGGG + Intronic
1093200012 12:16175145-16175167 TTTTCATAGTACAGAGATGAGGG + Intergenic
1094151634 12:27291004-27291026 TTATGCTGGTACAGGGAGGATGG - Intronic
1095295111 12:40518670-40518692 TTCTCTGAGCACAGGGAAGGTGG - Intronic
1097638848 12:62154486-62154508 TTATGTTAGTACAGAAAAGAAGG + Intronic
1097848960 12:64392814-64392836 TTCTCTTAGTCCTGGGAAGTAGG - Intergenic
1097935567 12:65246148-65246170 TTATCTTACAACAGGGAAATTGG + Exonic
1098114676 12:67162364-67162386 TTATTTCACTACAGAGAAGAAGG + Intergenic
1098860592 12:75705723-75705745 TTATCTTAGAACAAGGGAGTTGG + Intergenic
1099494277 12:83326486-83326508 TTTACTTAGGACAGGGAAAAAGG - Intergenic
1099856400 12:88173051-88173073 TTATCTTAGTTCACTGAATATGG - Intronic
1100370877 12:93967265-93967287 TTTTCTTAGTACAAGAAGGAGGG - Intergenic
1100556320 12:95697522-95697544 GAATCTTAGTATAGGAAAGATGG - Intronic
1100800214 12:98222934-98222956 TCATCTTAGTACAAGATAGAAGG - Intergenic
1101307078 12:103538974-103538996 TTATCTCAGAAAAGCGAAGAAGG + Intergenic
1104139433 12:125973218-125973240 TTATCTTAGTACCTGTAATAAGG - Intergenic
1105603801 13:21910240-21910262 TTCTCTGAGGACAGGGAAGATGG - Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1107195242 13:37643419-37643441 ATATTTGAGTACAGGGGAGAAGG + Intronic
1108710446 13:53027861-53027883 TTTTCTTTCTCCAGGGAAGAAGG + Intergenic
1109507585 13:63325975-63325997 TTATCTTAAAAAAAGGAAGAAGG - Intergenic
1109588901 13:64448973-64448995 TTATCTGAGAAGAGGTAAGATGG + Intergenic
1109694803 13:65940068-65940090 TTATCGTGGAACAGGGAAAAGGG - Intergenic
1110099315 13:71576871-71576893 TTATCTTATTACCCAGAAGAAGG - Intronic
1111610766 13:90603696-90603718 TTATATGAGTACAGGATAGAAGG + Intergenic
1114667865 14:24391253-24391275 ACTTCTTAGTACAAGGAAGAAGG + Intergenic
1115656627 14:35449521-35449543 TAATAATAGTACAGGTAAGAAGG + Intergenic
1116273511 14:42802071-42802093 TTTTCTTGGTGCTGGGAAGAAGG - Intergenic
1117513757 14:56479486-56479508 TTCTATTACTACAGGGCAGAAGG + Intergenic
1120928176 14:89819333-89819355 TTATCTGAGAAGAGGGAAGGGGG + Intronic
1121412233 14:93756189-93756211 TTATCTTAGGCCAGGCAAGGTGG - Intronic
1126361720 15:47853045-47853067 TTAACATAGCACAGGAAAGAAGG - Intergenic
1127804406 15:62505679-62505701 TTAACCAAGCACAGGGAAGAGGG - Intronic
1128105500 15:65041643-65041665 TTCTCTTATTAAAAGGAAGAAGG + Intergenic
1130529298 15:84733960-84733982 TTACCTTAGAAGAAGGAAGAAGG + Intergenic
1133700651 16:8305318-8305340 TTCTCTTGGCAAAGGGAAGAAGG - Intergenic
1138185945 16:54977795-54977817 TTATTTCAGTTCAGGGTAGAGGG + Intergenic
1138197927 16:55067609-55067631 TTATTTTAGTTCAGAGTAGAAGG - Intergenic
1138264326 16:55649597-55649619 TTATTTTAGAGCAGGGAACAGGG + Intergenic
1138662834 16:58534592-58534614 TTAATGTAGAACAGGGAAGATGG + Intronic
1142452330 16:90185001-90185023 TTAGCTTTGTACTGGGAGGAGGG + Intergenic
1143059556 17:4188306-4188328 GTATCTTGGTACAGGACAGAGGG - Intronic
1146532870 17:33625025-33625047 TGATCCTGGTACAAGGAAGAAGG - Intronic
1147855308 17:43475381-43475403 TTTTCTACTTACAGGGAAGATGG - Intergenic
1148118951 17:45196346-45196368 TTAACTTAAAACAGGGAAGTTGG - Intergenic
1149227551 17:54492117-54492139 TTATGTTGGTCAAGGGAAGAAGG + Intergenic
1150265234 17:63827945-63827967 TTATTTTAGTCCTGGGAAAATGG + Intronic
1151164722 17:72193760-72193782 TCAGCTTAGTAAAGGGCAGAAGG + Intergenic
1151901599 17:77019608-77019630 TCAACTTAGTACAGGGAGAAAGG + Intergenic
1151911171 17:77084228-77084250 TTATTTTAGTAGAGACAAGAAGG - Intergenic
1152937785 17:83150517-83150539 TTCTCTCAGAACAGGGAAGGTGG + Intergenic
1155721158 18:29013357-29013379 TTATCTTATTTGGGGGAAGAGGG - Intergenic
1157788669 18:50510030-50510052 TTATCCTAATACAGGGAGTAAGG + Intergenic
1157994442 18:52538251-52538273 TTGACTTAGTACTGTGAAGAAGG - Intronic
1160207121 18:76843841-76843863 TAATCCCAGCACAGGGAAGAAGG + Intronic
1160645156 19:184067-184089 TTAGCTTTGTACTGGGAGGAGGG - Intergenic
1162103814 19:8357499-8357521 TTTTCTTAGTAAAGGGCAAAAGG + Intronic
1162962351 19:14135817-14135839 GTATCTCACTACAGGAAAGAGGG + Intronic
1166211726 19:41310700-41310722 TCAGCTTGGTACAGGGAAGGAGG - Intronic
927254999 2:21033507-21033529 TCTTCTTAGTACCTGGAAGATGG + Exonic
927723464 2:25402918-25402940 CTTTCTTAGTAGAAGGAAGAAGG + Intronic
928098679 2:28422084-28422106 TTATATTCTTACAGGGATGAGGG + Intergenic
929041496 2:37749121-37749143 CTATCTTTGTACAGGGATAATGG + Intergenic
929251444 2:39760246-39760268 TCATCTTATGACAGGGAAGAGGG + Intronic
931471966 2:62547445-62547467 TAATATTAGTAGTGGGAAGAGGG - Intergenic
931473368 2:62562846-62562868 TTTTCATTTTACAGGGAAGATGG + Intergenic
936483827 2:112909662-112909684 TGCTCTCAGGACAGGGAAGATGG - Intergenic
940607409 2:155943747-155943769 TTAACTTAGTATTGGAAAGATGG + Intergenic
940656431 2:156492661-156492683 TCATGTTAGTATAGGGGAGAGGG + Intronic
942671635 2:178382189-178382211 TTATCTTAGTAGGGGCAGGAGGG - Intronic
944935389 2:204561895-204561917 TGACCTTAATACAGGGGAGATGG - Intronic
945442085 2:209892192-209892214 TTACATTAGTCCAGGGAAAAGGG + Intronic
947735607 2:232453403-232453425 TTATCTTGTTAAAGGGGAGATGG + Intergenic
947836146 2:233177056-233177078 TTATCTTAGTCTAAAGAAGAAGG + Intronic
947942147 2:234066973-234066995 ATGTCTTAGTTCAGGGAGGAAGG + Intronic
948056229 2:235010959-235010981 TTCTCCTAGAAGAGGGAAGAAGG - Intronic
948181932 2:235989194-235989216 ATATCTAATTCCAGGGAAGAAGG - Intronic
948205925 2:236162952-236162974 TTAATTTAGTGCAGGGAGGACGG + Intergenic
949083772 2:242129644-242129666 TTAGCTTTGTACTGGGAGGAGGG + Intergenic
1170034331 20:11973999-11974021 TACTATTAGTACAAGGAAGAAGG + Intergenic
1172262173 20:33576957-33576979 TAAAATTAGGACAGGGAAGATGG - Intronic
1172461819 20:35124653-35124675 TTATCTGAGGCCAGGCAAGATGG - Intronic
1176280357 20:64302175-64302197 TTAGCTTTGTACTGGGAGGAGGG + Intergenic
1178866352 21:36330761-36330783 TGATATTTGTACAGGGGAGAAGG + Intronic
1182950599 22:34371960-34371982 TTATCATGGTACATCGAAGACGG - Intergenic
1183169633 22:36177516-36177538 TTAGGTTAGTCCAGGGAAAAGGG - Intergenic
949669775 3:6386341-6386363 GTATCTTATTACTGGGAAAAAGG - Intergenic
951842211 3:27046631-27046653 TTATCTTAAGACTGGGAAGTAGG - Intergenic
952421341 3:33134117-33134139 TCATCTTAGAACTGGGAGGAGGG - Intronic
953083078 3:39639445-39639467 TTATCTTAATAAAAGGAAAAGGG + Intergenic
954514090 3:51155551-51155573 TTACCTTAGAATAGGGAAAAGGG + Intronic
955531289 3:59875475-59875497 TAATCTTTGTTCAGGGAATAGGG + Intronic
957289416 3:78258939-78258961 TTATCCTCCCACAGGGAAGAAGG - Intergenic
959590692 3:108076880-108076902 TCTTCTTAGTACAGTAAAGATGG - Intronic
959877238 3:111398603-111398625 TTATTTTAGTACAGGTCAGCTGG + Intronic
960384353 3:117003171-117003193 TCACGTTAGTACAGTGAAGAAGG - Intronic
960985236 3:123274990-123275012 TTATCTTAGTATATAAAAGAGGG - Intergenic
963418800 3:145032723-145032745 TTGTCTTCCTACAGAGAAGAAGG + Intergenic
964873015 3:161334128-161334150 ATATCTTAGGACAGGAAAGAGGG - Intergenic
967011619 3:185440260-185440282 TTGTCATAGTACAGGGATGATGG + Intronic
967744071 3:193035298-193035320 GTAGGTTAGTACAGGTAAGAAGG + Intergenic
967756496 3:193175932-193175954 TCATCTTAGTGCAGGGGAGAGGG + Intergenic
968292807 3:197552045-197552067 TTGTCTGAGTTCAGGGGAGAAGG - Intronic
968372526 3:198235461-198235483 TTAGCTTTGTACTGGGAGGAGGG + Intergenic
969064033 4:4462888-4462910 TCATCTTAGTACAGTAAAGAAGG - Intronic
969065653 4:4478526-4478548 TTAGCTTAGAATAGGGTAGAGGG + Intronic
969690767 4:8702913-8702935 TTCTCTTAGTTCCTGGAAGAGGG - Intergenic
971079487 4:23193394-23193416 TTATCTTAGAACATATAAGAAGG + Intergenic
971269077 4:25121467-25121489 TTATCTTTGTACTGTGACGAAGG - Exonic
974424802 4:61727552-61727574 TTATCTCATTACAGAGAGGAGGG + Intronic
974826280 4:67134746-67134768 TTGTTGTAGTACAGGGAAAAAGG - Intergenic
977488200 4:97676414-97676436 TTAATTTAATACAGGGAATAAGG - Intronic
977790955 4:101102433-101102455 TATTCTTGTTACAGGGAAGAAGG - Intronic
977963106 4:103108119-103108141 TTATCTTAATAAAGAGCAGAGGG - Intronic
978639801 4:110856770-110856792 TCATCTCAGTAAAAGGAAGATGG + Intergenic
979261212 4:118647928-118647950 TTAGCTTTGTACTGGGAGGAGGG + Intergenic
981237961 4:142440284-142440306 TTATCAGAGTATAGGGCAGAAGG + Intronic
981450544 4:144892109-144892131 TTATATTAGTAAAGTGAAAAGGG - Intergenic
981816255 4:148834240-148834262 TTTCCTTAGTACAGGGCAGGTGG + Intergenic
982766090 4:159350606-159350628 TGACATTAGTACAGAGAAGAGGG + Intronic
982857971 4:160409235-160409257 TTTTCTGGGTACAGGGAAGAAGG + Intergenic
983150631 4:164275347-164275369 TTAGCTTTGTACTGGGAGGAGGG - Intronic
985323546 4:188741139-188741161 TTCTCTTAGGACTGGGATGAAGG + Intergenic
986646092 5:9917335-9917357 TTATCATGGTACAGCCAAGAGGG + Intergenic
987567647 5:19613543-19613565 TTATCTTAGTAGTGCAAAGAGGG + Intronic
988638257 5:33011389-33011411 GCCTCTTAGGACAGGGAAGAAGG + Intergenic
989531451 5:42512564-42512586 TTATCTGAGTACTGGGGACAGGG - Intronic
990201009 5:53374365-53374387 TTATCTTTGTCAATGGAAGAAGG + Intergenic
993065110 5:83088774-83088796 TTATCTTATTAGAAGGAAGTTGG - Intronic
993732313 5:91437138-91437160 TTACCATAATACAGTGAAGAGGG + Intergenic
994374441 5:99003398-99003420 TTATCTGTGTACTGGAAAGAGGG + Intergenic
997567405 5:134899538-134899560 TTATCAAAGTGCTGGGAAGAGGG - Exonic
998107051 5:139475395-139475417 TCATCTTGGTACAGGGCAGCAGG - Intergenic
1000933939 5:167285399-167285421 ATATTTTAGTAGAGGGAAAAGGG - Intronic
1002568939 5:180129179-180129201 TCATCTGAGTGCTGGGAAGATGG - Intronic
1002569192 5:180130370-180130392 TCATCTGAGTGCTGGGAAGATGG + Intronic
1002731766 5:181341003-181341025 TTAGCTTTGTACTGGGAGGAGGG + Intergenic
1002752763 6:133074-133096 TTAGCTTTGTACTGGGAGGAGGG - Intergenic
1004964006 6:20826224-20826246 TCATGTTAATACAGGGAGGAGGG + Intronic
1005202025 6:23358183-23358205 TTATCTTAGAGCAGGAAAGGAGG + Intergenic
1005524682 6:26634357-26634379 TTCTCTCAGTACAGTGGAGACGG + Intergenic
1013515830 6:110885077-110885099 TTATCTTAGTCAAGTGAAGCAGG + Intronic
1013705208 6:112825076-112825098 TTATGTCAGGACAGGCAAGAAGG - Intergenic
1014165145 6:118215829-118215851 TTATCTTAGCACTGTGAATATGG + Intronic
1015141292 6:129935771-129935793 TTATCTTTGTAGGGGGAACAGGG - Intergenic
1015680428 6:135801684-135801706 TTATCTCACTTCAGGGATGAAGG - Intergenic
1015868086 6:137747970-137747992 TTTTCTTAGAAGAGGGAAGCAGG + Intergenic
1016157003 6:140823194-140823216 ATATATTAATAGAGGGAAGAGGG - Intergenic
1016656963 6:146529969-146529991 TTTTCTTACTACATGGAGGATGG + Intergenic
1017312308 6:152988229-152988251 TTCTCTTAGGACTGGGATGAAGG - Exonic
1017945809 6:159095546-159095568 TTGTCAAAGAACAGGGAAGAAGG + Intergenic
1018563630 6:165128300-165128322 TTATCTTCGAAAAGGGAATAGGG - Intergenic
1019236019 6:170613316-170613338 TTAGCTTTGTACTGGGAGGAGGG + Intergenic
1020970930 7:14937650-14937672 GTATATTAGAGCAGGGAAGAGGG - Intronic
1023267772 7:38426060-38426082 TTATCTTTTTACAGGTAACATGG + Intronic
1027367489 7:77473559-77473581 TTCTCACAGTACAGAGAAGAGGG + Intergenic
1027537226 7:79418634-79418656 TGGTCTTTCTACAGGGAAGAAGG + Intronic
1027800749 7:82746240-82746262 CTATCTTGGTACAGGTAGGAGGG - Intergenic
1028131190 7:87175782-87175804 TTATCTTAGTTCAAGGTAAAGGG - Intronic
1030528102 7:110677808-110677830 ATAGGTTAGTACAGGGAGGAAGG + Intronic
1033990800 7:147283939-147283961 GTATCTTAGTAAAGGGAAGATGG - Intronic
1035511749 8:193256-193278 TTAGCTTTGTACTGGGAGGAGGG - Intronic
1037624146 8:20592985-20593007 TTATATTGGTACAGGATAGAAGG + Intergenic
1037637913 8:20717038-20717060 TTATCTAAGTTTAGGGAAGGTGG + Intergenic
1039139828 8:34374170-34374192 TTATCTTAGTAAAAGGGAGCTGG + Intergenic
1039325824 8:36484425-36484447 TTATCTTTAGACAGGCAAGAGGG + Intergenic
1041564916 8:59265805-59265827 TTCTCTTATTAGAGGGAAAAAGG - Intergenic
1042310812 8:67377969-67377991 TAATCTTAGAACACTGAAGAAGG - Intergenic
1043642019 8:82465741-82465763 TTAGCTTAGTAGAGGAAATAAGG + Intergenic
1044481933 8:92700742-92700764 TTATCTTAATGCAGAGAACAGGG + Intergenic
1045398463 8:101785637-101785659 CTGGGTTAGTACAGGGAAGACGG + Intronic
1045988343 8:108276554-108276576 TAATCTTAATTCAGAGAAGATGG - Intronic
1046301873 8:112304866-112304888 TTATCTTGGAACATGGAAGATGG - Exonic
1047014589 8:120710220-120710242 TAATCTTGGAGCAGGGAAGAAGG + Intronic
1047018678 8:120751184-120751206 TTATCTCAGGAGAGGGAAGAAGG + Intronic
1048171091 8:132107257-132107279 TACTCTTAGTAAATGGAAGAGGG - Intronic
1050446916 9:5733711-5733733 TTAACTTAGTACAAGAGAGAAGG + Intronic
1052454840 9:28683031-28683053 TTATCTCAGGACAGGGAAAGTGG - Intergenic
1055633899 9:78255109-78255131 TTATCTTAGAACAAGGTAAAAGG + Intronic
1058717283 9:107734193-107734215 ATATCTAAATACAGCGAAGATGG + Intergenic
1059750646 9:117244511-117244533 TTATCTTAGAACAGTGGGGAAGG + Intronic
1062756172 9:138293515-138293537 TTAGCTTTGTACTGGGAGGAGGG + Intergenic
1186790928 X:12998068-12998090 TTATCTTAGAGTGGGGAAGAAGG - Intergenic
1187484037 X:19685185-19685207 TTATCTTCCTACAGGTAAGGTGG + Intronic
1189459052 X:41222378-41222400 TTAGCTTATTACTGTGAAGAGGG + Intronic
1190531209 X:51378427-51378449 TTATCTTAGTAGTGCTAAGAGGG + Intergenic
1192803739 X:74492397-74492419 TTATCTAAGTAAAAGGTAGAGGG + Intronic
1193576771 X:83208806-83208828 TTAATTTAATACAGGAAAGAAGG + Intergenic
1195466604 X:105186146-105186168 TTATCTTAATGTAGGGGAGAGGG + Intronic
1196464448 X:115958364-115958386 TTTTCTTAGCAAAGGGCAGAGGG - Intergenic
1199575717 X:149311956-149311978 TTATTTGAGTACAGGATAGAGGG + Intergenic
1201323012 Y:12721395-12721417 GTTTCTTAGTACAGGGATTAAGG + Intronic
1202382681 Y:24290363-24290385 TTAGCTTTGTACTGGGAGGAGGG + Intergenic
1202488103 Y:25379761-25379783 TTAGCTTTGTACTGGGAGGAGGG - Intergenic