ID: 1077720740

View in Genome Browser
Species Human (GRCh38)
Location 11:4625997-4626019
Sequence GGCAAGGCCCCTTTAATGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077720732_1077720740 24 Left 1077720732 11:4625950-4625972 CCTGGCTCCCTGAAAAACGGATC No data
Right 1077720740 11:4625997-4626019 GGCAAGGCCCCTTTAATGGGCGG No data
1077720734_1077720740 16 Left 1077720734 11:4625958-4625980 CCTGAAAAACGGATCTCAAGAAA No data
Right 1077720740 11:4625997-4626019 GGCAAGGCCCCTTTAATGGGCGG No data
1077720730_1077720740 27 Left 1077720730 11:4625947-4625969 CCGCCTGGCTCCCTGAAAAACGG No data
Right 1077720740 11:4625997-4626019 GGCAAGGCCCCTTTAATGGGCGG No data
1077720733_1077720740 17 Left 1077720733 11:4625957-4625979 CCCTGAAAAACGGATCTCAAGAA No data
Right 1077720740 11:4625997-4626019 GGCAAGGCCCCTTTAATGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077720740 Original CRISPR GGCAAGGCCCCTTTAATGGG CGG Intergenic
No off target data available for this crispr