ID: 1077721853

View in Genome Browser
Species Human (GRCh38)
Location 11:4637772-4637794
Sequence ACTCACACACATTTTTTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077721853_1077721855 17 Left 1077721853 11:4637772-4637794 CCAGGAAAAAAATGTGTGTGAGT No data
Right 1077721855 11:4637812-4637834 TGTGCACGTGTGTGTTGTGGTGG No data
1077721853_1077721857 26 Left 1077721853 11:4637772-4637794 CCAGGAAAAAAATGTGTGTGAGT No data
Right 1077721857 11:4637821-4637843 GTGTGTTGTGGTGGTGCTGGTGG No data
1077721853_1077721854 14 Left 1077721853 11:4637772-4637794 CCAGGAAAAAAATGTGTGTGAGT No data
Right 1077721854 11:4637809-4637831 GTATGTGCACGTGTGTGTTGTGG No data
1077721853_1077721856 23 Left 1077721853 11:4637772-4637794 CCAGGAAAAAAATGTGTGTGAGT No data
Right 1077721856 11:4637818-4637840 CGTGTGTGTTGTGGTGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077721853 Original CRISPR ACTCACACACATTTTTTTCC TGG (reversed) Intergenic
No off target data available for this crispr