ID: 1077721854

View in Genome Browser
Species Human (GRCh38)
Location 11:4637809-4637831
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077721853_1077721854 14 Left 1077721853 11:4637772-4637794 CCAGGAAAAAAATGTGTGTGAGT No data
Right 1077721854 11:4637809-4637831 GTATGTGCACGTGTGTGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077721854 Original CRISPR GTATGTGCACGTGTGTGTTG TGG Intergenic
No off target data available for this crispr