ID: 1077722601

View in Genome Browser
Species Human (GRCh38)
Location 11:4643470-4643492
Sequence GAGGACAGAAAGAACACTTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 362}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077722600_1077722601 -8 Left 1077722600 11:4643455-4643477 CCAAATGAGAGAAGGGAGGACAG 0: 1
1: 0
2: 3
3: 40
4: 302
Right 1077722601 11:4643470-4643492 GAGGACAGAAAGAACACTTCAGG 0: 1
1: 0
2: 4
3: 30
4: 362
1077722593_1077722601 7 Left 1077722593 11:4643440-4643462 CCTAAACAGTGTCCCCCAAATGA 0: 1
1: 0
2: 1
3: 15
4: 176
Right 1077722601 11:4643470-4643492 GAGGACAGAAAGAACACTTCAGG 0: 1
1: 0
2: 4
3: 30
4: 362
1077722599_1077722601 -7 Left 1077722599 11:4643454-4643476 CCCAAATGAGAGAAGGGAGGACA 0: 1
1: 0
2: 0
3: 19
4: 345
Right 1077722601 11:4643470-4643492 GAGGACAGAAAGAACACTTCAGG 0: 1
1: 0
2: 4
3: 30
4: 362
1077722597_1077722601 -5 Left 1077722597 11:4643452-4643474 CCCCCAAATGAGAGAAGGGAGGA 0: 1
1: 0
2: 3
3: 32
4: 305
Right 1077722601 11:4643470-4643492 GAGGACAGAAAGAACACTTCAGG 0: 1
1: 0
2: 4
3: 30
4: 362
1077722598_1077722601 -6 Left 1077722598 11:4643453-4643475 CCCCAAATGAGAGAAGGGAGGAC 0: 1
1: 0
2: 1
3: 22
4: 272
Right 1077722601 11:4643470-4643492 GAGGACAGAAAGAACACTTCAGG 0: 1
1: 0
2: 4
3: 30
4: 362
1077722592_1077722601 23 Left 1077722592 11:4643424-4643446 CCACGCTTAGCAAGGACCTAAAC 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1077722601 11:4643470-4643492 GAGGACAGAAAGAACACTTCAGG 0: 1
1: 0
2: 4
3: 30
4: 362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077722601 Original CRISPR GAGGACAGAAAGAACACTTC AGG Exonic
901283714 1:8059658-8059680 CAGGACAGAAAGACCAGGTCTGG - Intergenic
901411315 1:9086212-9086234 GCGGGCAGAAAGAACCCATCGGG - Intronic
901573014 1:10177085-10177107 GAATACATAAAGAACTCTTCTGG - Intronic
902443942 1:16449626-16449648 TAGGACAGAAACACCACCTCTGG - Intronic
903707631 1:25298541-25298563 GAGTTCAGGAAGAACACTTGGGG - Intronic
903719612 1:25394813-25394835 GACTTCAGAAAGAACACTTGGGG + Intronic
904717634 1:32480919-32480941 AAGGGCAGAAAGGACACTTGTGG - Exonic
905863488 1:41364957-41364979 GTTGACAGACAGAACACCTCAGG + Intronic
907537786 1:55180618-55180640 GAGAACAGAAAGATGAGTTCAGG - Intronic
908112309 1:60909451-60909473 GAGTGAAGAAAGAACACTGCAGG - Intronic
908640316 1:66215720-66215742 GAGGCCAGGGAGAACTCTTCTGG + Intronic
908806454 1:67937691-67937713 ATGGGCAGAAAGAACACTTGAGG + Intergenic
909378125 1:74963728-74963750 CAAGACAGAAAAAAAACTTCTGG - Intergenic
910223825 1:84916475-84916497 AAGGACAGAAAAAACCCATCAGG - Intergenic
910524660 1:88164194-88164216 GAGGCCAGAAATGACACATCAGG + Intergenic
911671516 1:100613722-100613744 AGAGACAGAAAGAACACATCTGG + Intergenic
912618602 1:111132645-111132667 GAGAACAGGAAAAACACTTTGGG + Intronic
912718083 1:111996216-111996238 GAGGACAGAAAGAAGAATGAGGG + Intergenic
912773917 1:112491531-112491553 GAAGACAGGAAGAGCATTTCAGG + Intronic
914442178 1:147717627-147717649 GATAGCTGAAAGAACACTTCGGG - Intergenic
914808848 1:151011703-151011725 GAGGCCACAAAGAACATATCAGG + Intronic
915325830 1:155080760-155080782 GAGGACAGAAAGGAGGCTCCCGG - Intronic
916930692 1:169575537-169575559 GAGAACAGATAGAAGACTCCAGG + Intronic
917356082 1:174127916-174127938 AAGAAAAGAAAGAAAACTTCAGG - Intergenic
917928913 1:179810522-179810544 GAGGGCAGAATGAACAGTCCAGG - Intronic
918145240 1:181750375-181750397 AAAGACAGTCAGAACACTTCAGG - Intronic
918244549 1:182647292-182647314 GAGGACAGAAAGCTTACTTCAGG - Intronic
918521230 1:185416997-185417019 GAGGATAGATAGTACACTTAGGG + Intergenic
919271852 1:195358812-195358834 AAGAAGAGAAAGAAAACTTCAGG + Intergenic
919847354 1:201650278-201650300 GGGGAGAGAAAGAGCAGTTCCGG - Intronic
920187958 1:204173580-204173602 GAGGACTGAAAGAGCAATTTAGG - Intergenic
920351049 1:205338291-205338313 GAGGACAGAAAGGCCACACCTGG + Intronic
920585378 1:207153807-207153829 GAGTACAGAAAAAACAGTTGAGG + Intergenic
920591762 1:207226347-207226369 GAGGGCACACGGAACACTTCTGG - Intergenic
920856553 1:209667410-209667432 GAGAAGAGGAAGAACACCTCTGG - Intergenic
921898915 1:220429913-220429935 AAGGTCAGAAAAAACACTGCAGG + Intergenic
921941358 1:220843297-220843319 GAGGACTGAAAGAATATTCCAGG - Intergenic
923165364 1:231356308-231356330 GAGGGCAGACAGATCACTTGAGG - Intergenic
923351156 1:233108318-233108340 GAGGAGAGAAAGATACCTTCAGG + Intronic
924099591 1:240589814-240589836 GAGGAAGGAAAGAAAAATTCTGG + Intronic
1062768541 10:82802-82824 GAGGGCTGGAAGAACACTGCTGG + Intergenic
1063155018 10:3371452-3371474 GTGGACAGAGAGAACCCATCAGG - Intergenic
1063243852 10:4198212-4198234 GAGGGCAGAAAGGACATTTCTGG + Intergenic
1063911068 10:10831325-10831347 GAGGGCAGTCAGGACACTTCTGG + Intergenic
1064287924 10:14008738-14008760 GACCACAGACAGAACACATCAGG + Intronic
1064949328 10:20830069-20830091 GAGAACAGAACACACACTTCAGG + Intronic
1066125445 10:32337333-32337355 GAGGAAAGAAAGAACAGTTTGGG - Intronic
1066617891 10:37314390-37314412 GAGGATAGATAAAATACTTCAGG - Intronic
1068228995 10:54145558-54145580 GAGGACAGAGAAAACTTTTCTGG + Intronic
1068848104 10:61703981-61704003 GTGGGCAGATAGAACACTTGAGG + Intronic
1069128811 10:64672766-64672788 GAGGTCAGAATGAAAACTGCAGG - Intergenic
1070278938 10:75034831-75034853 GAAAACAGAGAGAACACTCCCGG - Intergenic
1071152420 10:82651215-82651237 GAGAACAGGAAGACCACTTTAGG + Intronic
1072236919 10:93461482-93461504 GAGGAAAGAAAGGTGACTTCAGG + Intronic
1072422175 10:95298070-95298092 GAGGACAGAAAAAACAATAAAGG + Intergenic
1073015177 10:100393175-100393197 CAGGGCAGACAGATCACTTCAGG - Intergenic
1073023611 10:100469144-100469166 GAGTATAGAAAGAAAAATTCAGG - Intronic
1074480200 10:113812777-113812799 CAGCAAAGAAAGAAAACTTCAGG + Intergenic
1074719872 10:116255109-116255131 GAGGAAAGAAAACACATTTCTGG + Intronic
1075584272 10:123645784-123645806 GAGCACAGACAGAACCATTCCGG + Intergenic
1077722601 11:4643470-4643492 GAGGACAGAAAGAACACTTCAGG + Exonic
1079194841 11:18316480-18316502 GAAGACAGCAAGAACACTAACGG + Intronic
1079562282 11:21837012-21837034 GAAGAAACAAAGAACCCTTCAGG + Intergenic
1079594058 11:22219402-22219424 GGGTACACAAAGAACAGTTCTGG - Intronic
1080140747 11:28916997-28917019 GAGGACAGGAACAACACACCTGG + Intergenic
1081497987 11:43634859-43634881 GATGACAGAATAAAGACTTCAGG + Intronic
1083165049 11:60879162-60879184 GAGAAGAGAAAGAACCCCTCAGG + Intergenic
1084671324 11:70608271-70608293 GAGGAAAGAAATATCCCTTCTGG - Intronic
1084794783 11:71497856-71497878 GAGGATAGAATGTAAACTTCAGG + Intronic
1085622652 11:78049168-78049190 AAGGAAAGAAAGTACACTTGGGG + Intronic
1086137467 11:83456447-83456469 GAGGACAGAAAAATCAATACAGG + Intronic
1087382074 11:97418054-97418076 GATGACATAAAGTACAATTCTGG + Intergenic
1088751687 11:112847532-112847554 GAGGACAGAACTGACTCTTCAGG + Intergenic
1089094004 11:115903027-115903049 GGGGACAGAAACAACAGGTCAGG + Intergenic
1090272350 11:125396859-125396881 GAGGATAGAGAAAACAATTCTGG + Intronic
1090469654 11:126969037-126969059 GATGTCAGAAGTAACACTTCAGG + Intronic
1091822545 12:3487116-3487138 GAAGACACTAAGAACACTGCTGG + Intronic
1092218048 12:6695945-6695967 GAAGACAGAAATGACTCTTCTGG - Intronic
1092228686 12:6765374-6765396 GAGGACAGAAAGAGGAGTTGAGG + Intronic
1092339719 12:7665136-7665158 TGGGAGAGGAAGAACACTTCAGG - Intronic
1093293214 12:17354824-17354846 GAGGAGAGAAAAAACTCTTATGG + Intergenic
1094412522 12:30182439-30182461 GATGACAGAAAGCAGACTGCTGG + Intergenic
1094443561 12:30505730-30505752 GAGGACAGAGAGTCCATTTCAGG - Intergenic
1095519930 12:43051495-43051517 GAGGAAAGAAAGATCACTTCAGG + Intergenic
1095684140 12:45013016-45013038 GGGGCCAGAAAGAACACTTGTGG + Intergenic
1095858905 12:46892635-46892657 ATGGACAGAAAGAACACTCGGGG - Intergenic
1096020348 12:48319265-48319287 GAGGAAGGAAAGAACTCTTAAGG + Intergenic
1096035329 12:48463620-48463642 AAAGAAAGAAAGAAAACTTCAGG + Intergenic
1097503669 12:60438073-60438095 GAGGACAGGACAAGCACTTCTGG + Intergenic
1097655675 12:62359584-62359606 GAGGACAGATAGAACGGTTATGG - Intronic
1097991249 12:65836410-65836432 TAGGAGTGAAAGAACACTTATGG + Intronic
1098548444 12:71736976-71736998 GAAGACAGAAATCACAGTTCGGG - Intergenic
1098644584 12:72882645-72882667 GAGGAAAGCAAGAAGACCTCTGG - Intergenic
1099810608 12:87577915-87577937 TAGTAGAGAAAGAACACTCCAGG + Intergenic
1100359189 12:93860630-93860652 GAGGCCTGAAAGAACATTTTGGG + Intronic
1100670787 12:96810328-96810350 AAGGACAGAAAGAACACAAGAGG - Intronic
1102037367 12:109779604-109779626 GAGGCCAGCTAGGACACTTCAGG + Intergenic
1102903046 12:116653547-116653569 GAGGTCAGCAAGATCACTTGAGG + Intergenic
1104320094 12:127742782-127742804 GTGAGCAGAAAGAACACTTCAGG - Intergenic
1105788779 13:23776224-23776246 GCAGACATAAAGAACTCTTCAGG + Intronic
1106341375 13:28830722-28830744 GGGGACAGAAAGATTACTTGAGG + Intronic
1108558616 13:51621074-51621096 GAGGACAGAAAGTTTACCTCAGG - Intronic
1109751963 13:66706021-66706043 GAGTATAGAAAGCACACTTGGGG + Intronic
1109946382 13:69437740-69437762 GAAGACAGAAAGAACATTACCGG - Intergenic
1110530133 13:76587854-76587876 GAGGAAGGAAAGATGACTTCTGG + Intergenic
1112334635 13:98504026-98504048 GAAGACAGAAAGATCACATTTGG + Intronic
1112811061 13:103219373-103219395 CAGGCCTGAAAGAATACTTCAGG - Intergenic
1112828555 13:103420825-103420847 CTGGACATAAAGAACAGTTCTGG + Intergenic
1113139628 13:107132912-107132934 AAAGAAAGAAAGAAAACTTCTGG - Intergenic
1114723797 14:24911787-24911809 GAGGAACCAAAGAACTCTTCTGG - Intronic
1114853524 14:26409709-26409731 GAGGACATAAGGAGCATTTCAGG - Intergenic
1115707329 14:36012694-36012716 ATGGGCAGAAAGAACACTTGGGG + Intergenic
1116040753 14:39683823-39683845 GAGAACTGAAAGAAGACATCAGG - Intergenic
1116838565 14:49795779-49795801 GAGGACAAAAGGTAAACTTCAGG - Exonic
1117630396 14:57684665-57684687 GAGGCCAGGAAGAGCTCTTCAGG - Intronic
1118439250 14:65798269-65798291 GAGGACAGAGAGCATCCTTCTGG + Intergenic
1120360663 14:83497700-83497722 GAGGAAAAAAAGAATACTTAAGG - Intergenic
1122168447 14:99850196-99850218 GAGAACACAGAGAACACTTTGGG - Intronic
1122874276 14:104656353-104656375 GAGAACAGACAGAACAATTTTGG + Intergenic
1123415700 15:20093470-20093492 GAGGACAGACAGAAGTCTGCAGG + Intergenic
1123525039 15:21100584-21100606 GAGGACAGACAGAAGTCTGCAGG + Intergenic
1126057623 15:44745949-44745971 GGGGACAGAAAGAATGCTTAAGG + Intronic
1126233787 15:46358052-46358074 AAGGAAGGAAAGAAAACTTCGGG + Intergenic
1126297632 15:47158722-47158744 GAGGAGAGAAAGGACATTTCAGG + Intergenic
1129083414 15:73062643-73062665 TAAGACAGAAAGAACAATTTTGG + Intronic
1129558992 15:76545741-76545763 GAAGACAGAAATAAGAGTTCAGG + Intronic
1129958117 15:79657848-79657870 GAGGACAAAAGGAAGACTGCAGG - Intergenic
1130241375 15:82196022-82196044 GAAGGGAGAAAGAACACTTGAGG + Intronic
1130459050 15:84145133-84145155 GAAGGGAGAAAGAACACTTGAGG - Intergenic
1130775351 15:86974858-86974880 CAGGAGAGAAACCACACTTCTGG + Intronic
1132281706 15:100622839-100622861 GAAAACAGGAAAAACACTTCAGG + Intronic
1132472300 16:112216-112238 GTGGGAAGAAAGAACATTTCTGG + Intronic
1132720018 16:1311072-1311094 GAGGACAGAAGGCAGACTTTCGG + Intronic
1132781817 16:1630909-1630931 GGAGACAGAAAGAACACCACGGG - Intronic
1132856480 16:2047377-2047399 GAGGACAGCAAGTTCACTGCAGG + Intronic
1133739985 16:8644110-8644132 GAGAACAGAGAGAAAACTGCTGG - Intronic
1135571724 16:23554562-23554584 GAGGAGAGAAAAAGCTCTTCTGG + Intronic
1135641504 16:24123602-24123624 GAGGAAAGAAATGACAGTTCTGG + Intronic
1136609278 16:31356598-31356620 GAGGAGACAAAGAACACTTTAGG - Intronic
1136677856 16:31929675-31929697 CAGCAAAGAAAGAAAACTTCAGG + Intergenic
1137821940 16:51454438-51454460 GAGGAGGGAAAGAAAATTTCAGG - Intergenic
1138085404 16:54129189-54129211 TAGGACAGAAAGAAGACTGCTGG + Intergenic
1138190400 16:55009527-55009549 GAGGACAGAAAGCAGACTTGGGG - Intergenic
1138258692 16:55596349-55596371 GAGGAAAAAAAGAAACCTTCAGG + Intergenic
1138731586 16:59201291-59201313 GAGGGCAGGAAGAACCCATCAGG - Intergenic
1140702693 16:77596989-77597011 GGGGACAGGAAGATCACTTTAGG + Intergenic
1140756112 16:78068391-78068413 GAGGACAGGCAGATCACTTAAGG - Intergenic
1140794151 16:78420578-78420600 TAGGACAGAAAGTACACTGATGG + Intronic
1140806694 16:78538562-78538584 GAGAACAGAATGAGCAGTTCAGG - Intronic
1141480719 16:84304874-84304896 GAGGGCAGAGGGAACACTTTGGG + Intronic
1144186330 17:12799605-12799627 GCGGAGAGAAAGAAGACTGCTGG - Intronic
1144325232 17:14172923-14172945 CAAGACAGAAAGATCACTTGAGG - Intronic
1144474108 17:15569805-15569827 CAAGACAGAAAGATCACTTGAGG - Intronic
1144515170 17:15912431-15912453 GAGGAAAAAGTGAACACTTCAGG - Intergenic
1144796677 17:17896165-17896187 GAGAACAGAAAGAACCCCTCTGG - Intronic
1146014248 17:29219730-29219752 TTGGAGAGAAAGAAGACTTCTGG + Intergenic
1146141712 17:30373850-30373872 ATGGGCAGAAAGAACACTTGGGG + Intergenic
1146491518 17:33286631-33286653 AAGGAGAGAAAGAGGACTTCAGG - Intronic
1146768393 17:35545430-35545452 GAGGACAGAAAGAACAGACTAGG + Intergenic
1147308587 17:39580063-39580085 GAGGACAAAAACAACTTTTCTGG - Intergenic
1148524063 17:48312960-48312982 GTAGACAGAAAGAAAACCTCTGG - Intronic
1148579189 17:48731709-48731731 AAGGACATAAAGAAGCCTTCTGG + Intergenic
1149068780 17:52514404-52514426 AAAGAAAGAAAGAAAACTTCAGG - Intergenic
1149156725 17:53639697-53639719 AAGGACAGAAACTACATTTCAGG - Intergenic
1151169500 17:72235094-72235116 CAGGGCAGAAAGGACACATCTGG + Intergenic
1151382144 17:73733220-73733242 GAGGACAGAGAAAGCACTTAGGG - Intergenic
1153521699 18:5960325-5960347 GAGGACAGAAAAAATACTGGGGG - Intronic
1156051713 18:32944203-32944225 GAGGAGAGAAATACCACTTCTGG + Intronic
1156539806 18:37898424-37898446 GAGGACAAAAAGAGCCCATCAGG + Intergenic
1157128144 18:44977170-44977192 GGGATCAGAAAGAACACATCTGG - Intronic
1157336166 18:46739112-46739134 GAGGAGAGAAAGAACACCGTGGG + Intronic
1157621658 18:49020606-49020628 GAGGCAAGAAAGACAACTTCAGG - Intergenic
1157888833 18:51395158-51395180 GAGGAAAAAAATAACTCTTCAGG - Intergenic
1158497704 18:57971112-57971134 GGTGACAGTAAAAACACTTCTGG - Intergenic
1158680462 18:59561952-59561974 GTGAGCAGAAAGAACACCTCAGG - Intronic
1158990372 18:62862714-62862736 AAGTACACAAAAAACACTTCTGG - Intronic
1159297931 18:66521443-66521465 GAGGACAGAATGACTTCTTCAGG + Intronic
1160031028 18:75260142-75260164 GGGCACAGAAAGAACCCCTCCGG - Intronic
1162804650 19:13131017-13131039 CAGGACAGAGATAACACTTCTGG - Intronic
1163654207 19:18536341-18536363 GAGAACAGAAAAAAAAGTTCTGG - Intronic
1164101878 19:22062465-22062487 AAAGAAAGAAAGAAAACTTCAGG - Intronic
1164920907 19:32088007-32088029 TAGGGCAGAAAGATCACTTGAGG - Intergenic
1164974026 19:32558068-32558090 GAGAGCTGTAAGAACACTTCAGG - Intergenic
1165039839 19:33061179-33061201 AAGGAGAGAAAGAGCCCTTCAGG - Intronic
1166324592 19:42041544-42041566 GAGGAGAGAAATGACACTTAAGG + Intronic
1166940083 19:46357347-46357369 GAGAATAGAAAAAACACTTTGGG - Intronic
1167027617 19:46932573-46932595 GCTGATAGAAACAACACTTCAGG - Intronic
925342562 2:3147434-3147456 CAGGACAGAAAGGAGACCTCGGG + Intergenic
925747274 2:7054265-7054287 GATGGCTGAAAGAACACTTGCGG - Intronic
926293964 2:11553864-11553886 TCTGACAGAAAGAACACATCGGG - Intronic
926351689 2:12001202-12001224 AAGGACAGTAAGATCATTTCCGG + Intergenic
926507223 2:13732350-13732372 GTGGACAGAGAGAACCCATCAGG - Intergenic
927730783 2:25469677-25469699 GAGGCCAGACAGATCACTTGAGG - Intronic
928478763 2:31658907-31658929 CAAGAAAGAAAGAAAACTTCAGG + Intergenic
929440801 2:41964631-41964653 GAGGACAGAATGAAAGGTTCAGG + Intergenic
930546134 2:52769471-52769493 CAGGAAAAAAAGAAAACTTCAGG + Intergenic
930853382 2:55985999-55986021 CAGGACAGAAAGAGCTTTTCTGG - Intergenic
931147072 2:59530787-59530809 GAGGAGAGAAAAAAGACTTATGG - Intergenic
931840057 2:66138901-66138923 CAGAACAGAAAGAGTACTTCAGG + Intergenic
931933746 2:67171520-67171542 GAGGACAGAAGGCACAAATCTGG - Intergenic
932042348 2:68313992-68314014 GAGGAAAGAAAGAGCATTTGAGG - Intronic
932968412 2:76506678-76506700 GAGGGCAGAAATAAAACATCGGG + Intergenic
933278557 2:80307496-80307518 GAGGAAAGAAAAAAAACTTCAGG - Intronic
935958222 2:108399546-108399568 GAGACCAGGATGAACACTTCTGG - Intergenic
936243767 2:110809167-110809189 GAAGAAAGAAAGAAGACTCCTGG - Intronic
938077581 2:128347965-128347987 GAGCAGAGAAAGAAGACTGCAGG - Intergenic
938877526 2:135548069-135548091 GATGTCAGAAAAAAGACTTCAGG - Intronic
939609594 2:144294228-144294250 GAGTTCAGAGTGAACACTTCTGG - Intronic
939735351 2:145837311-145837333 GGGGACAGAAAGAAGGTTTCAGG + Intergenic
939799886 2:146696343-146696365 GAAGACAGAATGACCACCTCTGG + Intergenic
940696104 2:156981266-156981288 TAGTACAGAAACAACACTTAAGG + Intergenic
941164582 2:162071584-162071606 GAGGTTAGAAGGAACACTTCTGG - Intronic
941887677 2:170546068-170546090 GAGGAGGGAAAGAACACACCAGG - Intronic
942105548 2:172629813-172629835 GAGGCCAGGATGAGCACTTCTGG - Intergenic
944863244 2:203835309-203835331 GAGGAGGGGAAGAACATTTCAGG - Intergenic
944959721 2:204857725-204857747 AAGCATAGGAAGAACACTTCTGG + Intronic
944960684 2:204869303-204869325 GAGGAGCGAAAGAACAGTCCTGG - Intronic
945600488 2:211856713-211856735 GAGGAAAGAAAGCAGACTTCTGG + Intronic
946008859 2:216548775-216548797 GAGAACAGAAAGAACTTCTCAGG - Intronic
947877292 2:233476201-233476223 GAGGGCAGAAAGGACACCGCTGG - Exonic
948334854 2:237200007-237200029 GAGGAGAGCTAGAACCCTTCGGG - Intergenic
1168821517 20:776621-776643 GTGGGCAGAAAGAACCCCTCAGG - Intergenic
1169361655 20:4955011-4955033 GAGGCCAGAAGGATCACTTCAGG + Intronic
1169844077 20:9970935-9970957 GTGGACAGGAAGAACCCCTCAGG - Intergenic
1172475767 20:35236348-35236370 GAAGAGAGAAAGAAAACTCCGGG - Intronic
1173653336 20:44681791-44681813 GAGAACAGAAGAAATACTTCTGG + Intergenic
1177152908 21:17472565-17472587 GAGGATAGAAGGAACAGATCTGG - Intergenic
1177202696 21:17975655-17975677 TAGTACAGAAGGAATACTTCTGG - Intronic
1177272455 21:18867103-18867125 AAGGAAAAAAAGAAAACTTCAGG - Intergenic
1177483942 21:21730818-21730840 GAGTGTAGAAAGAACACTTATGG - Intergenic
1177625192 21:23650275-23650297 GGGGACAGGAAAAAGACTTCTGG + Intergenic
1177887286 21:26762061-26762083 GAGGACAAGAAGAACACCTTGGG - Intergenic
1177988046 21:28002814-28002836 CATGACAGAAAGAAAACTACAGG + Intergenic
1180929503 22:19579302-19579324 GAGGACAGGAAGAACCCAGCTGG - Intergenic
1181662424 22:24362108-24362130 GTGACCAGAAAGAACAATTCTGG + Intronic
1182308153 22:29385668-29385690 AAGAACAGAAAAATCACTTCTGG + Intronic
1182340739 22:29618863-29618885 GAAGACAGATAGAACAATTCTGG + Intronic
1182341754 22:29628225-29628247 GAGGAAAGACAGAAAACTTGGGG + Intronic
1182544386 22:31066009-31066031 GAGGACAGACAGAAGTCTGCAGG - Intronic
1182785623 22:32905353-32905375 GAGGACAAAAACCACACTTAGGG + Intronic
1183057289 22:35314716-35314738 GTGGTCAGGAAGGACACTTCTGG + Intronic
949774001 3:7610978-7611000 AAGGACAGACAGAATACTACTGG - Intronic
950329092 3:12141994-12142016 GAGGACAGAAAGACCCTTACCGG - Exonic
950662239 3:14473650-14473672 GAAGACAGAACGAAAACATCAGG + Intronic
951078307 3:18424218-18424240 GAGGACAGAAAGTCTACTTCTGG + Exonic
951511835 3:23510882-23510904 GGAGACAGAAAGAACAATTAGGG + Intronic
952487516 3:33829670-33829692 GAGGATAGAAAGATGACTTATGG + Intronic
955918649 3:63931480-63931502 GAGGCCATAGAGGACACTTCGGG + Intronic
956265431 3:67391431-67391453 GAGGAGAGAAAGAAACCTTTGGG + Intronic
957797587 3:85031469-85031491 GAAGATAGAAAAATCACTTCGGG - Intronic
957918057 3:86711609-86711631 GAGGAAAGAAAAAACAATTTTGG - Intergenic
957992911 3:87650322-87650344 GAGGAAAAAAAGAAAATTTCAGG - Intergenic
959121750 3:102241190-102241212 GAAGACAGACAGATAACTTCAGG - Intronic
960948251 3:122981708-122981730 GAGCAGAGAAAGAACACTTTTGG + Intronic
962481122 3:135799625-135799647 GAGGACACAGAAAGCACTTCTGG + Intergenic
962968191 3:140373530-140373552 GAGGACAGAAAGATTTGTTCTGG - Intronic
963836298 3:150061328-150061350 GAGGGCAGAAAGGACACTGCTGG - Intergenic
964901619 3:161665940-161665962 GAAAACAGGAAAAACACTTCAGG - Intergenic
965318096 3:167215670-167215692 CAAGACAAAAAGAAAACTTCAGG + Intergenic
965394183 3:168142204-168142226 GATGACAGAAATAATACTTTAGG - Intergenic
965940757 3:174178218-174178240 GAAAACAGAAAGCATACTTCTGG - Intronic
966377769 3:179314453-179314475 GAGGACAGAAAAAACAGATACGG + Intergenic
967487468 3:190050149-190050171 TAGGACAGAATGAACTCTTTTGG - Intronic
968775629 4:2537715-2537737 GAGGACCAAAGGAAAACTTCCGG - Intronic
970366839 4:15368021-15368043 AAGGACAGAAAGAAACTTTCAGG - Intronic
970412431 4:15821884-15821906 AAAGAAAGAAAGAAAACTTCAGG + Intronic
970504591 4:16714667-16714689 GAGGACAGAAATAAAAATTTTGG + Intronic
971846855 4:31929437-31929459 GTGGGCAGAAAGAACTCATCAGG + Intergenic
973082765 4:46014626-46014648 GAGGAGAGAGAGAAGATTTCTGG - Intergenic
973850515 4:54957060-54957082 GTGAACAGATATAACACTTCTGG - Intergenic
974827543 4:67150591-67150613 ATGGGCAGAAAGAACACTTGGGG + Intergenic
975322947 4:73028692-73028714 TTAGACAGAAAGAACACTTCAGG - Intergenic
976714348 4:88107492-88107514 TAGGACACAAAGCACACTGCTGG + Intronic
978392017 4:108236848-108236870 GAGGCCAGAAAGAAGCCTACTGG + Intergenic
978407779 4:108398242-108398264 GAAGAGAGAAAGAACCCCTCGGG - Intergenic
978463426 4:108983342-108983364 GAGGACAGTAAGAGCATTTTAGG - Intronic
978993045 4:115110836-115110858 GAGAAAAAAAATAACACTTCAGG + Intronic
979007561 4:115321060-115321082 GAAGGCAGAAAGAAAATTTCAGG + Intergenic
979159031 4:117435158-117435180 GAGAACAAAAGGAACAGTTCAGG - Intergenic
979728453 4:123992538-123992560 GAGGCCAGAATGAGCACTTCTGG - Intergenic
980613523 4:135188745-135188767 GAGAACAGAAACAACTCTTGGGG + Intergenic
980697024 4:136371352-136371374 GAGGAAATAAAGTACACTTATGG + Intergenic
981533560 4:145776222-145776244 TAAGACAGAAAGATCACTTAAGG + Intronic
981594152 4:146400206-146400228 GAGGACAGAAAAATCACCACTGG + Intronic
982288577 4:153759036-153759058 GAGGACAAAAATAACTCTTAAGG - Intronic
982568226 4:157014371-157014393 GAGAACAAAAAGATGACTTCTGG - Intergenic
982611518 4:157580039-157580061 GAGCTCAGAAACAAGACTTCTGG + Intergenic
983907630 4:173200930-173200952 GAGAAAAGAAAGAACATTTATGG + Intronic
986267110 5:6200431-6200453 GAGGGCAGAATGAACACATTGGG - Intergenic
987439403 5:17937799-17937821 GAAAACAGGAAAAACACTTCAGG + Intergenic
987886419 5:23819346-23819368 AAGAAAAGAAAGAACACTACTGG + Intergenic
988214768 5:28257052-28257074 GAGGAAAGTAATAACATTTCAGG - Intergenic
988372454 5:30388667-30388689 GCGGACAGCAAGAACCCCTCAGG + Intergenic
988404956 5:30812260-30812282 AAGGACAGAAATAAAACATCTGG + Intergenic
988734800 5:34009462-34009484 GAAAACAGATAAAACACTTCAGG + Intronic
988882621 5:35520000-35520022 GTGGTCAGAAAGAACCCATCAGG - Intergenic
990062677 5:51671420-51671442 GAGGACAGAAAAGTGACTTCTGG - Intergenic
990303882 5:54476130-54476152 GAGGAATGAAAGAACACCTGTGG - Intergenic
991990332 5:72332040-72332062 GAGAACAGAAACATCACTTTGGG + Intronic
992183501 5:74221569-74221591 GGGGATTCAAAGAACACTTCAGG - Intergenic
992353919 5:75959677-75959699 GATGACATAAAGTACAATTCAGG + Intergenic
992475758 5:77100259-77100281 GTAGACAGAAAGTACACTACGGG - Intergenic
993462368 5:88199466-88199488 GGGGAAAGAAAGAAAACTGCAGG + Intronic
994319652 5:98378230-98378252 GAAGGAAGAAAGAACACTACTGG + Intergenic
994424966 5:99573778-99573800 GATAACTGAAAGAACACTTGGGG + Intergenic
995960923 5:117838349-117838371 TAGAGCAGAAAGAACATTTCTGG - Intergenic
996864243 5:128101653-128101675 GAGAACAGAAACAAAACTTCTGG - Intronic
997633968 5:135390853-135390875 GAGGACAGAAAACAGAATTCTGG + Intronic
997670669 5:135669299-135669321 GAGGTGGGAAAGGACACTTCTGG + Intergenic
998151158 5:139758324-139758346 GGGGACAGGAAGTACATTTCAGG + Intergenic
1000224974 5:159251836-159251858 TAAGACAGAAGGATCACTTCAGG - Intergenic
1000825944 5:166043603-166043625 TAGAACAGAAAGGACATTTCAGG + Intergenic
1002451868 5:179323357-179323379 AAGGACAGAGAGAATACTTTGGG + Intronic
1002652502 5:180710453-180710475 AGGGACAGAAAGAACATTTGGGG + Intergenic
1002835135 6:859579-859601 GCAGACAGGAAGAACACATCAGG - Intergenic
1003709817 6:8576691-8576713 GAGGACAGAAAGTACACGATGGG + Intergenic
1003750934 6:9055035-9055057 GAGGACAGTAGGAAAACTGCTGG + Intergenic
1004719899 6:18259829-18259851 TCGCACAGAAAGAATACTTCAGG + Intronic
1005152041 6:22762761-22762783 AAAGAAAGAAAGAAAACTTCAGG - Intergenic
1005500398 6:26424279-26424301 GAGGACTGAAAAAGCCCTTCAGG + Intergenic
1005529932 6:26692913-26692935 CAGGACAGAAAGAACAGTGATGG - Intergenic
1005540864 6:26808734-26808756 CAGGACAGAAAGAACAGTGATGG + Intergenic
1009011676 6:57850823-57850845 CAGGACAGAAAGAACAGTGATGG + Intergenic
1010804290 6:80216527-80216549 GAGGACACCAAAAACACATCAGG - Intronic
1011170488 6:84499405-84499427 GGGGACAGTAAGAGCACTACAGG - Intergenic
1012222105 6:96661347-96661369 CAACACAGAAAGAAAACTTCAGG + Intergenic
1012314282 6:97766570-97766592 GAAGAGAGAAAGGTCACTTCAGG + Intergenic
1013063304 6:106658860-106658882 GAGGACAGAAAAAATATTTGAGG - Intronic
1013509718 6:110833404-110833426 GGGGAAAAAAAGAACACTTCAGG + Intronic
1013519088 6:110916131-110916153 GAGGCCAGGAGGAACACTTGCGG + Intergenic
1013690546 6:112637134-112637156 AAGGAAAGACAGAACACTTAAGG - Intergenic
1015141244 6:129934908-129934930 GAGGACAAAAAGCACACTGCAGG - Intergenic
1015656025 6:135520121-135520143 GAGGCTAGAAAGAACACAACAGG - Intergenic
1015704986 6:136078081-136078103 GAGGAAAGAAAGATCACATGAGG + Intronic
1018507354 6:164485553-164485575 GAGGACAGAAAGAAGGCATGAGG + Intergenic
1019181944 6:170192898-170192920 GAGGACAGTCAGCAAACTTCAGG + Intergenic
1019204991 6:170353441-170353463 GAACAAAGAAAGAAAACTTCAGG + Intronic
1020158142 7:5744669-5744691 GAAGAAATAAAGAAAACTTCTGG + Intronic
1020563705 7:9769088-9769110 AAAGAAAGAAAGAACACTCCTGG - Intergenic
1020773336 7:12423362-12423384 GAGGACACAAAGAACATTGCTGG - Intergenic
1021987934 7:26115167-26115189 GAAGACAGAAACAACACCTAAGG + Intergenic
1022253226 7:28629410-28629432 GAGGCCAGAAAGAAGAATTCAGG - Intronic
1022303260 7:29121583-29121605 GAGGATTGAAAGCACATTTCAGG + Intronic
1022483179 7:30757609-30757631 ATGGACAGAAAGAACACTCAGGG - Intronic
1023073309 7:36459008-36459030 GAGGGAAAAAAGAACACCTCAGG + Intergenic
1024162658 7:46693902-46693924 GAGGAGACAAAGAACATTGCGGG + Intronic
1024206995 7:47172211-47172233 GAAGACAGAAAGTACACTGGTGG + Intergenic
1027209473 7:76133695-76133717 GAGTACAGAGAGACCACTTGGGG + Intergenic
1027724615 7:81788487-81788509 ACGGGCAGGAAGAACACTTCCGG - Intergenic
1028571877 7:92298053-92298075 GAGAACAGAAAGAATACTGGAGG - Intronic
1029281801 7:99440033-99440055 GAAGACACAAAGAAAACTACTGG - Intronic
1029370504 7:100147772-100147794 GGGGACAAAAAAACCACTTCGGG + Intergenic
1030937757 7:115606711-115606733 GAAGACAGAAATAACAATACTGG + Intergenic
1033538789 7:142336932-142336954 GAGTCCAGAAAGAAGACATCAGG - Intergenic
1036986693 8:13539852-13539874 TAGGACAGAAGAAACACTCCAGG + Intergenic
1037059139 8:14485241-14485263 GAGGAGAAAAAGAAAAATTCTGG - Intronic
1037641681 8:20750062-20750084 GAGGCAAGAAAGGACTCTTCTGG + Intergenic
1039339240 8:36628590-36628612 GAGGGCAGAACCAACACTTTTGG - Intergenic
1040311501 8:46239150-46239172 GAGGATAGAAATAACAAGTCCGG + Intergenic
1040391211 8:46952016-46952038 GATGATAGAAAGAACAGTTATGG - Intergenic
1041207449 8:55512841-55512863 GAAGGCAGAAAGAACACCTGTGG - Intronic
1041565678 8:59275514-59275536 AAGGAGAGAAAGCACACTCCAGG + Intergenic
1041578980 8:59434637-59434659 GAGGAAAGAAAGAAAACATAAGG + Intergenic
1043083488 8:75796932-75796954 AAGAACATAAAGAAAACTTCTGG + Intergenic
1043695217 8:83208656-83208678 GAGGAAAGAAACAACACTTCTGG + Intergenic
1044170762 8:89049326-89049348 GAAGAAAAAAATAACACTTCAGG - Intergenic
1044750489 8:95411156-95411178 GAGGACAGAAGGAACCCATGGGG - Intergenic
1044905839 8:97001694-97001716 AAAGAAAGAAAGAAAACTTCAGG - Intronic
1045005313 8:97912334-97912356 GAAGCCAGAAATAACATTTCAGG - Intronic
1047155224 8:122309641-122309663 GAGAACAGCAAGAACACATATGG + Intergenic
1048340165 8:133532751-133532773 AAGGGCAGGAAGAACAGTTCTGG - Intronic
1050852735 9:10308151-10308173 GAAAACAGGAAAAACACTTCAGG - Intronic
1052290235 9:26832171-26832193 GTGGACAGAAAGAACCCATCAGG - Intergenic
1052349811 9:27447227-27447249 GAGGGCAGAAAGAAGCCCTCTGG + Intronic
1052865345 9:33461686-33461708 GAGGAGGGAAAGATCACCTCAGG + Exonic
1052913056 9:33901412-33901434 GAGTACAGAATGAAAAGTTCAGG - Intronic
1057485512 9:95479917-95479939 GAGGAAAGGAAGAAGACTACAGG + Intronic
1058552080 9:106125442-106125464 GAGGGCAGGAAGAACAATTCTGG + Intergenic
1058944598 9:109844406-109844428 GAACAAAGAAAGAACACTTGTGG + Intronic
1059667528 9:116462964-116462986 GATGACAGGAAGAACAGTTTTGG - Intronic
1060895266 9:127212918-127212940 GAGGAGAGCAACAACACATCCGG - Intronic
1186055821 X:5648903-5648925 GTGGGCAGAAAGAACCCCTCAGG - Intergenic
1187418078 X:19110741-19110763 GAGGACAGAAAGAACATTCCAGG + Intronic
1187525733 X:20053054-20053076 GAGGACAGGAAGGACACTTCGGG - Intronic
1187997744 X:24946650-24946672 GAGGACAAAGAGATCACTTATGG - Intronic
1188950444 X:36366156-36366178 AGTGACAGAAAGAACATTTCTGG - Intronic
1190402629 X:50054175-50054197 GAGGACAAAAAGTATACTACTGG - Intronic
1192198855 X:69050725-69050747 GAGTAGAGAAAGAACATTCCAGG - Intergenic
1192628576 X:72756356-72756378 GAGGCCAAACAGAAAACTTCAGG + Intergenic
1192653132 X:72964458-72964480 GAGGCCAAACAGAAAACTTCAGG - Intergenic
1193096704 X:77556437-77556459 GAAGAGAGAAAGAAAACTACTGG + Intronic
1194536810 X:95115782-95115804 AAAGAAAGAAAGAAAACTTCAGG - Intergenic
1195905240 X:109837883-109837905 GAGGACAAAAGGAACACTATTGG - Intergenic
1196370383 X:114972117-114972139 GAGTACAGAAACAAAATTTCAGG + Intergenic
1197128515 X:122976148-122976170 CAAGACAGAAAGGACATTTCCGG - Intergenic
1197613312 X:128663234-128663256 GAGGACTGAGAGAAAACCTCAGG - Intergenic
1197790583 X:130249819-130249841 AAGGACAGAAAAAAGAATTCAGG + Intronic