ID: 1077726027

View in Genome Browser
Species Human (GRCh38)
Location 11:4675822-4675844
Sequence AAATGGCACCAATTTAAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077726027_1077726031 25 Left 1077726027 11:4675822-4675844 CCCACTTTAAATTGGTGCCATTT No data
Right 1077726031 11:4675870-4675892 TTCTTCAAAGCCATAGAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077726027 Original CRISPR AAATGGCACCAATTTAAAGT GGG (reversed) Intergenic
No off target data available for this crispr