ID: 1077726031

View in Genome Browser
Species Human (GRCh38)
Location 11:4675870-4675892
Sequence TTCTTCAAAGCCATAGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077726028_1077726031 24 Left 1077726028 11:4675823-4675845 CCACTTTAAATTGGTGCCATTTC No data
Right 1077726031 11:4675870-4675892 TTCTTCAAAGCCATAGAAGTAGG No data
1077726030_1077726031 0 Left 1077726030 11:4675847-4675869 CCACGTTTTTCTGCTTTTGTGCT No data
Right 1077726031 11:4675870-4675892 TTCTTCAAAGCCATAGAAGTAGG No data
1077726027_1077726031 25 Left 1077726027 11:4675822-4675844 CCCACTTTAAATTGGTGCCATTT No data
Right 1077726031 11:4675870-4675892 TTCTTCAAAGCCATAGAAGTAGG No data
1077726029_1077726031 8 Left 1077726029 11:4675839-4675861 CCATTTCTCCACGTTTTTCTGCT No data
Right 1077726031 11:4675870-4675892 TTCTTCAAAGCCATAGAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077726031 Original CRISPR TTCTTCAAAGCCATAGAAGT AGG Intergenic
No off target data available for this crispr