ID: 1077726921

View in Genome Browser
Species Human (GRCh38)
Location 11:4684033-4684055
Sequence CAGTTTGGCCTTAATGTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 121}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077726914_1077726921 30 Left 1077726914 11:4683980-4684002 CCAGAATTCTTCACTCATCATCT 0: 1
1: 0
2: 1
3: 29
4: 226
Right 1077726921 11:4684033-4684055 CAGTTTGGCCTTAATGTAGAGGG 0: 1
1: 0
2: 0
3: 10
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077726921 Original CRISPR CAGTTTGGCCTTAATGTAGA GGG Intronic
900725945 1:4216418-4216440 CAGTTTTGCATGAGTGTAGAGGG + Intergenic
901325011 1:8360618-8360640 CAGGTTGGCATTCATGGAGAAGG + Exonic
902556813 1:17251671-17251693 CAGTTTGGCCTTACTTCAAAGGG + Intronic
904691934 1:32299724-32299746 CAGTTTGCACTTAATCTAGAGGG - Intronic
906229786 1:44152260-44152282 CAGTTTGGACTTAATCACGAGGG - Intergenic
906269657 1:44465886-44465908 GAGTTTTGCCTTAATGTTGATGG + Intronic
912427518 1:109607811-109607833 CAGTAAGACCTTAAGGTAGATGG - Exonic
912427765 1:109609830-109609852 CAGTAAGACCTTAAGGTAGACGG - Exonic
912814143 1:112815517-112815539 CAGTCAGGCCTTAAGGTTGATGG + Intergenic
917013108 1:170497491-170497513 CAATTTGCTCTTAATGCAGATGG + Intergenic
918339001 1:183551919-183551941 CACTTTGGCCTCAGTGTGGAGGG - Intronic
921701705 1:218275874-218275896 CAGTTATGCCTTAATATAGCTGG - Intergenic
923160981 1:231314352-231314374 CAGTGTGGCCTGAGTGGAGATGG + Intergenic
924176594 1:241397568-241397590 CAGCTTGACCTTAAACTAGAAGG + Intergenic
924274418 1:242371183-242371205 CAGTTTCTCCTTATTTTAGAAGG + Intronic
1063131126 10:3178270-3178292 CACTATGGCCTTAAGGTAGGTGG - Intergenic
1071261316 10:83921819-83921841 CAATTTGGCCTTAAAAAAGAAGG + Intergenic
1072570080 10:96650873-96650895 CAGTTTGGATTTTATCTAGAAGG + Intronic
1075510890 10:123072392-123072414 CATTGAGGCCTTAATGTAAAAGG - Intergenic
1077726921 11:4684033-4684055 CAGTTTGGCCTTAATGTAGAGGG + Intronic
1078085346 11:8230317-8230339 GAGGTTGGCCTTGGTGTAGAGGG + Exonic
1082221971 11:49649813-49649835 CAGTTAGATCTTAATTTAGAGGG + Intergenic
1086627060 11:88969384-88969406 CAGTTAGATCTTAATTTAGAGGG - Intronic
1087577176 11:100003926-100003948 CAGATTGGTCTTTAGGTAGAGGG - Intronic
1090424460 11:126597430-126597452 CATATTGGCCTTAAAGAAGATGG - Intronic
1090510486 11:127369524-127369546 CAATTAGGCCTCAATGTACAGGG - Intergenic
1091521777 12:1252734-1252756 CAGTATTGCCTTAAAGTAGTTGG + Intronic
1094216282 12:27946123-27946145 CAGTTTGGCTTTAATATCCATGG + Intergenic
1098941158 12:76538088-76538110 TGGTATGGCCTTGATGTAGATGG - Intronic
1099936064 12:89127167-89127189 CAGTTTAGTCTTTATGTAAAAGG + Intergenic
1110904030 13:80863046-80863068 CAGATTTTGCTTAATGTAGATGG - Intergenic
1112992606 13:105532325-105532347 AAGTTTGGACTTCATTTAGAGGG + Intergenic
1115665983 14:35547670-35547692 CAGTTTGGCATTAAAAAAGATGG - Intronic
1116364603 14:44044189-44044211 CTGTTTGGCCTTACTCTAGGGGG + Intergenic
1120024297 14:79565517-79565539 AAATTTGGCCTTAATATAAATGG + Intronic
1120871125 14:89338479-89338501 CAGTTTGGCCCTTATATATATGG - Intronic
1121395882 14:93622800-93622822 CAGTTTGTCCAGAATGTTGAAGG - Exonic
1121910521 14:97787117-97787139 GAGTCTGGCCTTCATGTTGATGG - Intergenic
1124271627 15:28287413-28287435 CAGGGTGGCTTTAATGAAGAGGG - Intronic
1126556198 15:49990103-49990125 TAGTTTGGCCTAAATCTAAAGGG + Intronic
1131896407 15:97035442-97035464 CAATTTGACATTAATGGAGACGG + Intergenic
1132849271 16:2017200-2017222 CAGTGTGGCCTTCCTGGAGAGGG + Intronic
1136110258 16:28060146-28060168 AAGTTTAGCCTTGATGTATAGGG + Intronic
1137017525 16:35392741-35392763 GAGTGTGGCCTGAATGTGGAAGG - Intergenic
1137085028 16:36109509-36109531 CAGTTTCTGTTTAATGTAGAAGG - Intergenic
1139102785 16:63788631-63788653 AAGGTTGGCCTTAATATTGACGG + Intergenic
1142881166 17:2883469-2883491 GATTTTGGCCTTGATGGAGAGGG + Intronic
1144174507 17:12692151-12692173 CAGTTTTCCCTTCATGTAAATGG + Intronic
1145721154 17:27074205-27074227 CGGTCTGCCCTTAATGGAGAAGG - Intergenic
1146307716 17:31743421-31743443 GAGGTTGACCTTAATGAAGAAGG + Intergenic
1147392263 17:40117349-40117371 CCGTGTGGCCTTAATGGATAAGG - Intergenic
1149149834 17:53548142-53548164 CATTTATGCCTTAATGAAGATGG - Intergenic
1151290430 17:73146039-73146061 CATTTTGCCCTGAATGGAGACGG - Intergenic
1151538236 17:74750437-74750459 CAGTTCGGCATTAAGGTAGAAGG + Intronic
1153760010 18:8321609-8321631 CAGTCTGCCCTTAATGGAGAAGG + Intronic
1155848439 18:30738742-30738764 CAATTTGACCTTAATGTGGTTGG + Intergenic
1158606879 18:58903373-58903395 AAGTTTGGACTTAATTTGGAAGG + Intronic
1163228583 19:15981416-15981438 CAGGCTGTCCTTAATGTACATGG + Intergenic
1168448931 19:56447956-56447978 CAATTTGGCGTTACTGCAGAGGG - Intronic
925214834 2:2085451-2085473 CAGCATAGACTTAATGTAGAAGG - Intronic
926892316 2:17649264-17649286 CAGTTTGGCCTGACTGTCAAGGG - Intronic
928702060 2:33909071-33909093 CAGTATGGCCCTAATGAAGTAGG - Intergenic
928716054 2:34062114-34062136 CAGTCTTGCCTTAATGTTGATGG + Intergenic
930205710 2:48585012-48585034 AAATTTGGCATTAATGAAGAAGG - Intronic
930831756 2:55751181-55751203 GAGTTTTGCCTCAATGTTGATGG - Intergenic
935444243 2:103139559-103139581 AAGTTGGGCCTAAATGTAGAAGG + Intergenic
935730652 2:106062560-106062582 CAGTTTGTGCATAATGCAGAAGG + Intergenic
937837557 2:126487724-126487746 CAGGTTGCCCTTACTGAAGATGG + Intergenic
938886193 2:135651676-135651698 AAGTTTGGCCTATGTGTAGAAGG + Intronic
941287714 2:163634482-163634504 CAGTTTGGCTGTGGTGTAGATGG - Intronic
941583550 2:167329969-167329991 CAGTTTGACCATAATGTGCATGG + Intergenic
943787705 2:191897032-191897054 ATATTTGGCCTTAATTTAGATGG - Intergenic
944121029 2:196241180-196241202 CAATTTGCTCTTAATGTAAATGG + Intronic
944997388 2:205309207-205309229 CAGGTGGGCATTAATGTAAATGG + Intronic
946021181 2:216641245-216641267 CAGTTTGGCCTTCATTTTAAAGG - Intronic
1170831280 20:19843446-19843468 GAGTTTTGCCTTGATGTTGATGG - Intergenic
1175689097 20:61052888-61052910 GCGTTTGGCCATAATGGAGATGG + Intergenic
1177625213 21:23650613-23650635 AAGTTGGACCTTAATGGAGATGG - Intergenic
1182371929 22:29817323-29817345 GAGTTTGGACTTAATCTTGAGGG - Intronic
962989061 3:140562300-140562322 GAGTGTGGCCTTACCGTAGATGG - Exonic
963222415 3:142826593-142826615 AAGTTTGGCCTTAAAGAAGAAGG - Intronic
967035049 3:185642638-185642660 GAGTTTTGCCTCAATGTTGATGG - Intergenic
969998312 4:11337873-11337895 CATTTTAGCCTTAAAATAGAAGG + Intergenic
971805187 4:31349815-31349837 CAGTTTTGCCTTACTTTCGATGG + Intergenic
973238124 4:47928121-47928143 AAGTTTGGTCTCAATGTTGATGG + Intronic
975643118 4:76520156-76520178 AAATTTGGGCTTAATGTACAGGG - Intronic
976698504 4:87943842-87943864 CTGTTTGGCCTTGATGTTGGAGG + Intergenic
980698530 4:136393119-136393141 CAGTTTGGCCTTATCATAAAAGG + Intergenic
980870176 4:138602444-138602466 GGGTTTGGCCTTGATGTTGATGG - Intergenic
985692318 5:1320099-1320121 CAGCTTGGCCTTCAGGTTGAAGG - Intronic
985773427 5:1826980-1827002 CAGTTTAGCGTGAATGGAGAGGG - Intergenic
988268839 5:28987669-28987691 AAGATTGTCCTTAATGTGGACGG - Intergenic
989250497 5:39308959-39308981 CAGTTCATCCTTAATGTAGCTGG + Intronic
990858157 5:60295469-60295491 CTGTTGGGCTTTTATGTAGATGG + Intronic
994673577 5:102793177-102793199 CACTTTGGACTTAATTTACACGG - Intronic
995099711 5:108284774-108284796 AAGTTTTGCCTCAATGTTGATGG + Intronic
996767828 5:127052579-127052601 CAGTGTGGCTTTTATGTATATGG - Intronic
996910673 5:128654049-128654071 CAGTTTCTTCATAATGTAGATGG + Intronic
997776562 5:136613339-136613361 CAGTTTGGCCTAATAGTAAATGG + Intergenic
998951498 5:147396752-147396774 CAGTTTGGGCCTAATAGAGAAGG - Intronic
999357423 5:150948796-150948818 AAGTCTGGCCTTGATGGAGAAGG + Intergenic
1006088871 6:31616115-31616137 GAGTTTGACCTTAATGGAAATGG + Exonic
1013732110 6:113180630-113180652 CTCTTTGGCCTTAATGTACAAGG - Intergenic
1014017046 6:116544286-116544308 CAGTTTGGCCTTAATTATAAAGG - Intronic
1015585507 6:134772320-134772342 CAGTTTTGGTTGAATGTAGAGGG - Intergenic
1021601721 7:22371030-22371052 TAGTTTGGACTTAATGCAAAAGG - Intergenic
1021626554 7:22599139-22599161 GAGTTTGGCTTTTATTTAGAAGG + Intronic
1024970014 7:55060580-55060602 CACTTTGGCCATACTGAAGAAGG - Intronic
1031349124 7:120706599-120706621 CACATTGGCCTGAATGTTGAAGG + Intronic
1039006686 8:33045836-33045858 CCCTTTGGCCTTCCTGTAGAGGG - Intergenic
1043405386 8:79927065-79927087 CAGTTTAGACATTATGTAGAAGG + Intronic
1043595790 8:81883213-81883235 CAGTTTAGTCTTAGTGTATATGG + Intergenic
1045670722 8:104550456-104550478 CAGTTTTGCCTTAATGTCCTAGG + Intronic
1046183601 8:110684508-110684530 CAATTTGGCCATACTGGAGAAGG - Intergenic
1049055433 8:140232847-140232869 CAGTTTGAGATTAAAGTAGAAGG + Intronic
1051080293 9:13286249-13286271 AAGTTTGGCTTTCATGAAGAAGG - Intergenic
1051526721 9:18053169-18053191 CAGGTTGGACTTCATGGAGAAGG + Intergenic
1055696623 9:78891850-78891872 CAGCTTGGCCCTGATGAAGAAGG + Intergenic
1056060252 9:82877921-82877943 CAGTTTGTACTTAATGTTGAAGG + Intergenic
1056242113 9:84658094-84658116 CAGTTTGGTCTTTATGTAATTGG + Intergenic
1061650728 9:132047380-132047402 CAGTTTGGCCTTAAACTGTAAGG - Intronic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1186103886 X:6185250-6185272 CAGTTAGGACTAAAGGTAGAAGG - Intronic
1187047282 X:15659754-15659776 CTCTTTGGCCTGTATGTAGATGG - Intronic
1187331192 X:18341247-18341269 CAGCTTGGCCTTATTGAAGCTGG - Intronic
1187977724 X:24720025-24720047 CAGTTTGGACTTTATGTTGTAGG - Intronic
1189665518 X:43350849-43350871 CAGGTTGCCCCTAAGGTAGAAGG - Intergenic
1192144472 X:68672229-68672251 CAGATTGGCCTTAAGGAAGAAGG - Intronic
1195335382 X:103848365-103848387 CAGTTGGGCCTCAAAGTAAAAGG - Intergenic
1198322996 X:135537999-135538021 CAGTCTTGCCTTGATGTTGATGG + Intronic
1199092700 X:143710907-143710929 TGGTTTGGCATCAATGTAGAGGG - Intergenic
1202070609 Y:20988111-20988133 AAGTTTTGGCTTAATGTACAGGG - Intergenic