ID: 1077727644

View in Genome Browser
Species Human (GRCh38)
Location 11:4691454-4691476
Sequence CATGGTGACCAGAGTGGATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 1, 2: 1, 3: 12, 4: 138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077727642_1077727644 -8 Left 1077727642 11:4691439-4691461 CCAGAATATACTCAGCATGGTGA 0: 1
1: 0
2: 0
3: 18
4: 112
Right 1077727644 11:4691454-4691476 CATGGTGACCAGAGTGGATATGG 0: 1
1: 1
2: 1
3: 12
4: 138
1077727639_1077727644 5 Left 1077727639 11:4691426-4691448 CCCTCACATTGAACCAGAATATA 0: 1
1: 1
2: 0
3: 8
4: 162
Right 1077727644 11:4691454-4691476 CATGGTGACCAGAGTGGATATGG 0: 1
1: 1
2: 1
3: 12
4: 138
1077727640_1077727644 4 Left 1077727640 11:4691427-4691449 CCTCACATTGAACCAGAATATAC 0: 1
1: 1
2: 0
3: 9
4: 120
Right 1077727644 11:4691454-4691476 CATGGTGACCAGAGTGGATATGG 0: 1
1: 1
2: 1
3: 12
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077727644 Original CRISPR CATGGTGACCAGAGTGGATA TGG Intronic
900196567 1:1379426-1379448 CATGTTGCCCAGGCTGGATATGG - Intergenic
903862739 1:26374703-26374725 CATGATCACCAGAGTGGGTTTGG + Intergenic
904566542 1:31431805-31431827 CAGGGTGGACAGGGTGGATAGGG + Intronic
904566566 1:31431877-31431899 CAGGGTGGACAGGGTGGATAGGG + Intronic
904566638 1:31432093-31432115 CAGGGTGGACAGGGTGGATAGGG + Intronic
904566656 1:31432147-31432169 CAGGGTGGACAGGGTGGATAGGG + Intronic
905740357 1:40364959-40364981 CATGGTGGCCAAAGTGGATGAGG + Intronic
906853260 1:49276712-49276734 CATGGTGACAAGACAGGCTATGG - Intronic
909004985 1:70265216-70265238 CAAGGTGACAAGAGTGAAGAGGG + Intronic
909605936 1:77508384-77508406 CATGGTTACCAGAGTGAAGCTGG - Intronic
912254709 1:108047040-108047062 CATGGAGAACAGATTGGAGAGGG - Intergenic
914342334 1:146770828-146770850 CATGGCATCCAGACTGGATAGGG - Intergenic
915943289 1:160132541-160132563 CTTGGTGACCAAACTGGATATGG + Intronic
917239916 1:172937006-172937028 AGTGGTTACCAGAGTGGACAGGG + Intergenic
919640349 1:200039713-200039735 CATGCTGCCCAAAGTGGAGACGG + Exonic
923044139 1:230342896-230342918 CATTGTGACCAGTGTGGCTGCGG - Intronic
1064298947 10:14104652-14104674 CGTGGAGACCAGAGTGGCTGGGG - Intronic
1065593096 10:27285540-27285562 GATGGTGACCAAAGTGGACAAGG + Intergenic
1065657278 10:27964742-27964764 GATGGTGACCAAAGTGGACAAGG - Intronic
1067046659 10:42989000-42989022 CATGGTGGCCAGAGAGGAAGGGG - Intergenic
1071387069 10:85132103-85132125 CATGGTGACTATAGTTGATGAGG + Intergenic
1071724615 10:88185160-88185182 TATGGGGACGAGAGTGGATCTGG + Intergenic
1075955424 10:126519162-126519184 AAAGGTGAACAGAGTGGAGAGGG + Intronic
1076997951 11:308173-308195 CATGGTGACCAGCGGTGATCGGG - Exonic
1077187945 11:1243794-1243816 CATGGTCACCACCGTGGTTATGG - Exonic
1077727644 11:4691454-4691476 CATGGTGACCAGAGTGGATATGG + Intronic
1077729866 11:4718838-4718860 AATGGTGACCAGAGTGGATATGG - Intronic
1077894542 11:6443770-6443792 CTTGCTGCCCAGAGTGGATTTGG + Intergenic
1079466278 11:20734174-20734196 CATGGTGACTAAAGTAGAGAAGG + Intronic
1079659078 11:23017906-23017928 CATCTTGGCCAAAGTGGATATGG + Intergenic
1081830815 11:46111438-46111460 CATGTTGCCCAGGCTGGATATGG - Intronic
1083240527 11:61384657-61384679 CATGGTGTCCACACAGGATATGG + Intergenic
1086470379 11:87102853-87102875 CAGGGTGACCATAGTTAATAAGG - Intronic
1092961365 12:13599329-13599351 AATGGTGGCAAGAGTGGAAAAGG - Intronic
1097203946 12:57304200-57304222 CAAGGGGAAGAGAGTGGATAAGG + Intronic
1098890814 12:76008835-76008857 CATGTTGACCAGGGTGGACTCGG - Intergenic
1100670069 12:96802286-96802308 CTTTGTGACCAGAGTGGGTGGGG - Intronic
1101810533 12:108103896-108103918 CATGGTGGCCAGAGTTGTGATGG - Intergenic
1101945031 12:109130140-109130162 CATGGTGCTCTGAGTGGAGATGG + Intronic
1102601444 12:114033752-114033774 CATGGTGACCAAGATGGATAGGG + Intergenic
1106016245 13:25871955-25871977 CCTGCTGAGCAAAGTGGATAGGG - Intronic
1108779390 13:53810459-53810481 AATGGTGGCCAGAGGAGATAAGG - Intergenic
1116652205 14:47607728-47607750 CATGTAGGCCAGAGGGGATATGG + Intronic
1122675799 14:103412320-103412342 CACGGTGGCCAAAGTGGATGAGG - Intronic
1124899291 15:33807632-33807654 CATGGTGATCACAGTGCAGAGGG - Intronic
1125297225 15:38216320-38216342 CATAGGGTCCAGAGTGGAAAAGG + Intergenic
1126204474 15:46029484-46029506 CATGGTGACTATAGTTAATAGGG - Intergenic
1127960634 15:63887833-63887855 CATGGGGAAGTGAGTGGATAGGG + Intergenic
1132083576 15:98887817-98887839 CATGATGATCAGAGAGGGTAGGG - Intronic
1132823050 16:1886809-1886831 CATGGTGACCAAAGGCGATGTGG - Intergenic
1133253329 16:4499596-4499618 CATGGTGACTATAGTTAATATGG + Intronic
1133294353 16:4743652-4743674 CTTTGTGGCCCGAGTGGATAGGG - Intronic
1135720967 16:24817992-24818014 TGTGGTGAGCAGAGTGGATTGGG + Intronic
1139682403 16:68575192-68575214 CATGGTGGGCTGAGTGGATGAGG - Intronic
1139991942 16:70946592-70946614 CATGGCATCCAGACTGGATAGGG + Intronic
1140866363 16:79066017-79066039 CATGATGAACAGACTGGATTTGG - Intronic
1141591622 16:85073095-85073117 CCTGATGACTAGTGTGGATATGG - Intronic
1141730028 16:85816075-85816097 CACGGTGGCCAAAGTGGATGAGG - Intergenic
1141964485 16:87432631-87432653 CACGGTGACCAGGGTCGAGATGG - Intronic
1143646631 17:8234608-8234630 CAGGGTGGCCAGAGTGGGGAAGG + Exonic
1144399907 17:14886309-14886331 CCTGCTGACCTGAGTGCATAGGG - Intergenic
1145232420 17:21183737-21183759 CATGGACACCACAGTGGATGTGG + Exonic
1148678057 17:49456533-49456555 CAGCGTGACCAGAGTGGAGGGGG - Intronic
1150655705 17:67038047-67038069 CACGGTGACCAGCGTGCAGAGGG - Intergenic
1151370513 17:73644086-73644108 CATGGTGACCAGCCTGGAGAGGG + Exonic
1155474861 18:26227137-26227159 CCTGGTGACCAAAGTGGCTCCGG + Exonic
1156876404 18:42019001-42019023 CATGAAGAACAGAGTGGAAATGG - Intronic
1157714891 18:49877645-49877667 GATGGTGACCAGAGTGCCCAGGG - Intronic
1158287505 18:55900525-55900547 CAGGCAGACCAGAGTTGATATGG - Intergenic
1159941320 18:74411183-74411205 CATGGTGAACGGAGCTGATAGGG - Intergenic
1163865289 19:19768754-19768776 CATGCTGGCCAAAGTGGATGAGG + Intergenic
1166745657 19:45140764-45140786 CAATATGACCAGAGTGGATGTGG + Intronic
927191299 2:20519026-20519048 CATGGGGATCAGTGAGGATAAGG - Intergenic
927335307 2:21915923-21915945 CATGGTGACCAGGATGGAAGGGG - Intergenic
928525009 2:32131013-32131035 CATGTTGACCATAGTTGTTATGG + Intronic
932598162 2:73107029-73107051 AATGGTGGCCAGAGAGGAGAGGG - Intronic
933633310 2:84680679-84680701 CAGGGAGACCAGAATGGAAATGG + Intronic
938139249 2:128782931-128782953 CCTGGTGAGCAGTGTGGAGAGGG - Intergenic
938220382 2:129561163-129561185 CATGGTGAACAGTCTGGAGAAGG + Intergenic
939463470 2:142527593-142527615 CATGGTGCCCAGCCTGGATATGG - Intergenic
945582783 2:211616998-211617020 CATGGAAACAAGAGTGGAGATGG - Intronic
946284407 2:218692290-218692312 CAAGGTAACCAGAGTGGAGAAGG + Exonic
947718592 2:232354088-232354110 CATGGGGAGCTGAGTGGAGAAGG + Intergenic
1168983076 20:2024458-2024480 CATGGTCAGCAGAGTGGACCAGG - Intergenic
1171872468 20:30539416-30539438 CAAGGAAATCAGAGTGGATAAGG - Intergenic
1172126674 20:32628694-32628716 CCTGGTGGCCAGAGTGGAAGTGG + Intergenic
1172884612 20:38222752-38222774 CGTGGTGACGAGAGGGGACATGG - Intronic
1173570881 20:44075290-44075312 GATGGTGACAAGATAGGATAGGG + Intergenic
1174556664 20:51400444-51400466 CATGGTGCCCAGTGTTAATATGG + Intronic
1178391960 21:32206051-32206073 CCTGGTGACTACAGTGGATGGGG - Intergenic
1179410217 21:41156694-41156716 CAAGGTGTGAAGAGTGGATATGG + Intergenic
1180678252 22:17603876-17603898 CTGTGTGACCAGTGTGGATAGGG - Intronic
1181022470 22:20110736-20110758 CATCGTGTCCAGACTGGAGAGGG - Exonic
1182654009 22:31875229-31875251 CAGGGAGACGAGAGTGTATACGG - Intronic
1185069337 22:48647654-48647676 CCTTGTGACCAGAGTGGGTAGGG + Intronic
951560583 3:23962224-23962246 CATGGTGACCAGAGCTCACAAGG + Exonic
954414369 3:50385753-50385775 CATGGAGGCCAGAGTGGAAGCGG + Intronic
955685273 3:61543139-61543161 CATTGTGAACAGAGTGTACAAGG - Intergenic
955707399 3:61742658-61742680 CATGGTGGCCAAAGTGGGTGAGG - Intronic
960543812 3:118889385-118889407 CATGGTGGCCCAAGTGAATAAGG + Intergenic
962434163 3:135349003-135349025 CTTGGTCACCAGGGAGGATAAGG + Intergenic
962889051 3:139655170-139655192 CAGGGTCAACAGAGTGGCTAAGG + Intronic
964533724 3:157696510-157696532 CAAGGTGACTAGAGTGGATATGG - Intergenic
969056095 4:4403801-4403823 AATGCTGACCAGAGTGCAGAAGG + Intronic
969291706 4:6244335-6244357 CATGGGGACCAGAGCGCTTACGG + Intergenic
969848613 4:9939125-9939147 CATGGTAATCAGAGAGGAAATGG - Intronic
970174480 4:13325163-13325185 GATGGTGACCTGAAAGGATAAGG - Intergenic
978318726 4:107469535-107469557 CATGGTGACCAATGTGGCAAAGG + Intergenic
980250357 4:130306953-130306975 CATGGTAATCAAAGTGGAAAGGG + Intergenic
982652365 4:158102015-158102037 AATGGTGCCCAGAGAGGTTAAGG - Intergenic
984774941 4:183473485-183473507 GATGGTCACCAGGGTGGACAGGG - Intergenic
986702722 5:10427302-10427324 CATTGTGCCCAGTGTGGAGAAGG - Intronic
991650425 5:68847117-68847139 CATGGTGGCCAGACTGGAAGGGG + Intergenic
991995463 5:72382172-72382194 CATCGTGGCCAGAGTTGATGAGG + Intergenic
992000930 5:72435826-72435848 CATTCTGACTATAGTGGATAGGG - Intergenic
993354076 5:86884431-86884453 CATGGTGGCCAAAGTGGATGAGG - Intergenic
998000422 5:138620740-138620762 CATGGTGGCCAAAGTTGATGAGG + Intronic
999035145 5:148340486-148340508 AATGTTGAGCAGAGTAGATATGG + Intergenic
999271363 5:150298107-150298129 CATGGTGACCTGCATGGATGAGG - Exonic
999518775 5:152329008-152329030 CATGGTGCTCAGAGTGGAAGTGG + Intergenic
1002671823 5:180873690-180873712 CATGGTGACAAGACTGGAGGAGG - Intergenic
1004025832 6:11817811-11817833 CATGTTGACCAGAGTAGTTAGGG + Intergenic
1004136810 6:12975334-12975356 GATCCTGACCAGAGTGGAAAGGG + Intronic
1006637397 6:35470297-35470319 CATGGTGGCCAAAGTGGATGAGG + Exonic
1008340848 6:50362266-50362288 AATGGTGACCGGAGTATATATGG - Intergenic
1012453689 6:99381230-99381252 CATGGAGAACAGATTGGAAAGGG - Intronic
1014251244 6:119117500-119117522 CAAGGTGACCACAGTGGAAGAGG - Intronic
1015325220 6:131916987-131917009 CATGGTAACCTCAGTGGCTATGG + Intergenic
1015938610 6:138426763-138426785 AAGGGTGGCCAGAGTGGACAGGG + Intronic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1019984857 7:4648226-4648248 CATGGTGTCCAGAGAGGGAAAGG - Intergenic
1022117387 7:27274079-27274101 CATGGGGAACAGATTGGAAAAGG + Intergenic
1023818653 7:43968445-43968467 CCTGGTGCCCAGAAAGGATAAGG + Intergenic
1024392514 7:48831710-48831732 CATGGTGGCCAGTGGGGAGATGG - Intergenic
1026979409 7:74517853-74517875 CCAGGTGCCCAGAGTGGAGAGGG + Intronic
1038146889 8:24905451-24905473 CATGGAGACCAGGCTGGAGAGGG - Intergenic
1038659672 8:29486319-29486341 GATGCAGACCAGAGTGGAGAAGG + Intergenic
1039135979 8:34323195-34323217 CATGGTGGCCAAAGTGGACGAGG - Intergenic
1040411338 8:47157546-47157568 TATGGTGGCCAAAGTGGATGAGG + Intergenic
1043546747 8:81324059-81324081 CAGGGTGACTAGAATGGCTAGGG - Intergenic
1045226971 8:100257672-100257694 CAAGGTGACCAGAGAAGACATGG + Exonic
1045623020 8:104004986-104005008 CATAGAGTCCAGGGTGGATAAGG + Intronic
1046701491 8:117405828-117405850 CATAGTCACAAGAGTGGCTAAGG - Intergenic
1048192339 8:132301335-132301357 CATGGTGGCTGGAGTGGACAGGG - Intronic
1049627593 8:143632733-143632755 CGTGGTGACCACAGAGGACAGGG - Intergenic
1055083100 9:72287185-72287207 CATGATCATCAGAGTAGATATGG - Intergenic
1059955849 9:119515292-119515314 CAAGGTGGCAAGAGTGTATAAGG + Intronic
1186311473 X:8323813-8323835 CATGGTGAGCTGAGTAGATGGGG + Intergenic
1187125261 X:16448505-16448527 AATGGTGACCTGAATGTATATGG + Intergenic
1188758642 X:33997599-33997621 CATGGTGAAAAGGGTGGAAAGGG - Intergenic
1192568652 X:72184215-72184237 CATGGGGTCCAGAGTGGGAAGGG + Intronic
1195592951 X:106653330-106653352 CATGATGACTGGAGGGGATATGG + Intronic
1201701282 Y:16884615-16884637 CATGGTGCCCAGACTCAATAAGG - Intergenic