ID: 1077729836

View in Genome Browser
Species Human (GRCh38)
Location 11:4718660-4718682
Sequence GCTTCCAGCCCAGGAACACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 470
Summary {0: 1, 1: 0, 2: 2, 3: 62, 4: 405}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077729836_1077729838 -10 Left 1077729836 11:4718660-4718682 CCTGGTGTTCCTGGGCTGGAAGC 0: 1
1: 0
2: 2
3: 62
4: 405
Right 1077729838 11:4718673-4718695 GGCTGGAAGCCTTCCACACCTGG 0: 2
1: 0
2: 3
3: 10
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077729836 Original CRISPR GCTTCCAGCCCAGGAACACC AGG (reversed) Intronic
901790362 1:11650619-11650641 CCTTCCAGCGCAGGCACACCAGG + Exonic
901829266 1:11882144-11882166 GCCACAAGCCAAGGAACACCTGG + Intergenic
901978096 1:13011403-13011425 GGTTCCTGCCCAACAACACCAGG + Intronic
902003990 1:13217535-13217557 GGTTCCTGCCCAACAACACCAGG - Intergenic
902023213 1:13363279-13363301 GGTTCCTGCCCAACAACACCAGG - Intergenic
902059254 1:13628470-13628492 GCCACAAGCCAAGGAACACCTGG + Intergenic
902142001 1:14364799-14364821 GCCACAAGCCAAGGAACACCAGG - Intergenic
902400635 1:16155100-16155122 GCTGTCAGCCCAGGGCCACCAGG - Intronic
902875026 1:19335855-19335877 GCCTGCAGCCCATGAACCCCAGG + Intergenic
903268670 1:22174165-22174187 CCCTCCAGCCCTGGACCACCCGG + Intergenic
903315089 1:22497041-22497063 GCTTCCTGCCCTCGAACATCAGG - Intronic
903345590 1:22682233-22682255 ACCACCAGCCAAGGAACACCGGG - Intergenic
904337515 1:29807724-29807746 TCTTACAGCCCAGGAACTGCAGG - Intergenic
904479934 1:30787384-30787406 GCTCCCAGCCCACGAAGCCCTGG + Intergenic
904813855 1:33181351-33181373 GCTCGCAGCCCAGGCTCACCGGG + Exonic
906642203 1:47448266-47448288 TCTCCCAGCCCAGGAACCCTGGG - Intergenic
906732865 1:48098247-48098269 GCCACAAGCCAAGGAACACCTGG + Intergenic
906747205 1:48230509-48230531 CCTGCCTGCCCAGCAACACCAGG - Intronic
907431785 1:54416423-54416445 GCTTCCAACCCAGGAGGCCCAGG + Intergenic
910237123 1:85048038-85048060 CCTTCCAGCCCAGGGGCTCCGGG + Intronic
911049987 1:93662701-93662723 GCTTCCAACCAAGTAACCCCAGG + Intronic
912389833 1:109295283-109295305 TCTTCCAGCCCAAGATCATCTGG - Exonic
912550236 1:110480681-110480703 GCTTCCAGCCACAGGACACCTGG + Intergenic
913549874 1:119907055-119907077 GCTTCCTGCCCTTGAACATCAGG + Intergenic
914413808 1:147458609-147458631 GCTACAAGCCAAGGAACAACAGG + Intergenic
915637262 1:157195578-157195600 CCTGGGAGCCCAGGAACACCTGG + Intergenic
916506311 1:165430944-165430966 GAAACCAGACCAGGAACACCAGG - Intronic
917504918 1:175618856-175618878 GCCTTCTGCCCAGGAGCACCTGG + Intronic
918207625 1:182323663-182323685 GCTTCCACTCCAGAAAGACCTGG - Intergenic
918533974 1:185553838-185553860 GCTACAAGCCAAGGAACATCTGG - Intergenic
918881099 1:190122504-190122526 GCTACAAGCCAAGGAACACCAGG + Intronic
920368645 1:205462856-205462878 GCTACAAGCCTAGGAACGCCTGG - Intergenic
920911104 1:210217645-210217667 TCTACAAGCCAAGGAACACCAGG + Intergenic
921513750 1:216064762-216064784 GTTTGCAGCCCAGGAACAATAGG + Intronic
921523901 1:216193722-216193744 GCCACAAGCCAAGGAACACCAGG + Intronic
922610654 1:226924508-226924530 GCCTCCACCCCACGAACCCCAGG - Intronic
922934073 1:229410390-229410412 GCATCCATCCCAGGCACACAGGG + Intergenic
1062880152 10:971855-971877 GCTTCCAGCACGTGAACTCCGGG - Intergenic
1064414731 10:15139117-15139139 GCTTCCTGCCCTCGAACATCAGG + Intronic
1064423151 10:15207461-15207483 GCTTCCTGCCCTCGAACATCAGG - Intergenic
1065700742 10:28423194-28423216 GCTTCCAGCCCATGCTCTCCTGG + Intergenic
1066349896 10:34627609-34627631 CCTGCAAGGCCAGGAACACCTGG + Intronic
1066410124 10:35160143-35160165 GTTTGCAGCCCAGGAATAACAGG - Intronic
1067271200 10:44792732-44792754 CCTTTCAGCACAGGAAAACCTGG + Intergenic
1067830774 10:49610123-49610145 GCCTCCAGCCCTGGAGCATCTGG + Intronic
1068686309 10:59873401-59873423 GCTGCAAGCCAAGGAACGCCTGG + Intronic
1069024253 10:63522157-63522179 GCTCCCAGCCCAGGATCCCTGGG + Intronic
1070085831 10:73236369-73236391 GCTGCAAGCCAAGGAACACCAGG - Intronic
1070553006 10:77505683-77505705 GGTTGCAGCCCAGGAACACAGGG + Intronic
1070966213 10:80532877-80532899 GCTTCCAGCTTAGGAACCCCAGG + Exonic
1071339707 10:84633531-84633553 GCTTGTAGCCCAGGAGCAACAGG + Intergenic
1071600326 10:86955819-86955841 GCTTCCAGGCTTGGGACACCTGG + Intronic
1072626478 10:97115588-97115610 TCTTCCAGGCCTGGAAGACCTGG - Intronic
1073318480 10:102599553-102599575 TGTTCCAGCCCAGGGACACTGGG - Intronic
1074386046 10:113017514-113017536 GGCTCCAGCCAAGGAACACAGGG - Intronic
1074600351 10:114907695-114907717 GCCTCCAGGCAAGGAATACCTGG + Intergenic
1075125844 10:119698213-119698235 GCCACAAGCCAAGGAACACCTGG - Intergenic
1075155674 10:119974306-119974328 CCTCCCAGCCGGGGAACACCCGG + Intergenic
1075618843 10:123910880-123910902 GCCACAAGCCAAGGAACACCTGG - Intronic
1075721564 10:124590567-124590589 ACTTCTAGCCCAGGAGCTCCAGG + Intronic
1076264635 10:129100076-129100098 GCCACAAGCCAAGGAACACCAGG + Intergenic
1076425240 10:130363009-130363031 GCTACTTGCCCAGGAGCACCTGG - Intergenic
1076435092 10:130435161-130435183 GCTACAAGCCCAGGAACCCTGGG + Intergenic
1076444331 10:130501555-130501577 GCCACAAGCCCAGGGACACCTGG - Intergenic
1076917182 10:133430116-133430138 GCCTCCAGCCCAGGAGAAGCTGG - Intergenic
1076937277 10:133574875-133574897 GCCTCCAGCCCAGGAGAAGCTGG - Intergenic
1077482639 11:2823575-2823597 GCCTCCAGCCCAGGCAGCCCAGG + Intronic
1077539324 11:3139217-3139239 GCTTCCAGCCCTGGAGGAGCAGG + Intronic
1077542008 11:3151141-3151163 GCCACGAGCCAAGGAACACCTGG + Intronic
1077729836 11:4718660-4718682 GCTTCCAGCCCAGGAACACCAGG - Intronic
1078360581 11:10664642-10664664 GCTTCCAGCCCTGGGATGCCAGG - Intronic
1079056074 11:17207759-17207781 CCTTCCAGCCCGGGAACCCCGGG + Intronic
1079182806 11:18208802-18208824 GCTTCCTGCCCTCGAACATCAGG + Intronic
1079355517 11:19727226-19727248 TCAACCAGCCCAGGCACACCTGG - Intronic
1081110858 11:39131345-39131367 GCTTCCTGCCCTGGAACATCTGG + Intergenic
1081370950 11:42302360-42302382 GCTTCAAGCTAAGGAACACATGG + Intergenic
1081661048 11:44888630-44888652 GCTTCCAACCTAGGTACTCCTGG - Intronic
1081753296 11:45527475-45527497 TCTTCCAGCTCAGCAGCACCTGG - Intergenic
1083884858 11:65567907-65567929 GCTCCCAGCCCAGGAGATCCAGG - Intergenic
1083933968 11:65860762-65860784 GCTTCCGGCCCAGGCGGACCGGG - Exonic
1084350552 11:68595883-68595905 GCCTCCACCACAGGAACACATGG - Intronic
1084660209 11:70542366-70542388 GCTAGCAGCCAAGGAATACCGGG + Intronic
1084794598 11:71496652-71496674 GCCACAAGCCAAGGAACACCTGG - Intronic
1085030763 11:73269683-73269705 TCTTCCAGCACAGGTACACATGG + Intronic
1085166691 11:74407413-74407435 GCTACAAGCTAAGGAACACCTGG - Intergenic
1086926019 11:92641520-92641542 GCCTCAAGCCAAGGAATACCTGG - Intronic
1088360135 11:108980871-108980893 GCTCCCAGCCAGAGAACACCAGG - Intergenic
1091316767 11:134619370-134619392 GCATCCAGCCCAGGAGGACCAGG - Intergenic
1091854160 12:3725372-3725394 GCCTCAAGCCAAGGAACACCTGG - Intronic
1093926068 12:24909615-24909637 GCTGCAAGCCAAGAAACACCTGG - Intronic
1095409073 12:41902610-41902632 GCTACAAGCCCAGGAATGCCAGG - Intergenic
1095518771 12:43037288-43037310 GCTACAAACCAAGGAACACCAGG + Intergenic
1096526943 12:52215706-52215728 GCTTCCAGAACAGGAACTCGAGG - Intergenic
1096749461 12:53749450-53749472 GATTCCAGCCCAGCATCTCCAGG - Intergenic
1098097914 12:66979815-66979837 GCTGCAAGCCAAGGACCACCAGG + Intergenic
1099477743 12:83128072-83128094 GCTTGCAGCCCAGTAACATGGGG - Intronic
1100438993 12:94598223-94598245 GATTCCAGCCCAAGTGCACCTGG + Intronic
1100882312 12:99032434-99032456 GCCACAAGCCAAGGAACACCTGG - Intronic
1101285423 12:103306967-103306989 GCTGCAAGCCAAGGAACACCTGG + Intronic
1102559857 12:113754413-113754435 TGTTCCAGGCCAGGAACAGCAGG + Intergenic
1102794483 12:115676507-115676529 GCCACAAGCCAAGGAACACCTGG - Intergenic
1103201761 12:119093602-119093624 CCTTCCAGCCCAGGGTCCCCTGG - Intronic
1103511115 12:121475033-121475055 GTTTGCAGCCCAGGAGCAACAGG + Intronic
1103836332 12:123824098-123824120 GCTGCCACCCCAGGATCCCCTGG - Intronic
1103992708 12:124809929-124809951 CCTCCCAGCCCAGCACCACCTGG + Intronic
1104588239 12:130064274-130064296 GCTTCCTGCCCAGACACCCCTGG - Intergenic
1104787528 12:131459240-131459262 GTTTCCAGCTCAGCAGCACCTGG - Intergenic
1105014467 12:132777700-132777722 GCTGCAGGCCAAGGAACACCTGG - Exonic
1105210416 13:18253913-18253935 GCCTCCAGCCCAGGATGCCCTGG + Intergenic
1105955044 13:25273815-25273837 GCATCCGGCCTAGGAACAACAGG + Intronic
1106002377 13:25736386-25736408 GATTCCTACCCAGGAACACAGGG - Intronic
1107526342 13:41235628-41235650 GTTTCAAGCCGAGGAACACCTGG + Intronic
1107988192 13:45794000-45794022 GCTGCAAGCCAAGGAACACCTGG + Intronic
1108238440 13:48434583-48434605 TTTCTCAGCCCAGGAACACCAGG + Intronic
1108260356 13:48649572-48649594 GCTATAAGCCAAGGAACACCTGG - Intergenic
1111946280 13:94668990-94669012 GCGTGCAGCCATGGAACACCAGG + Intergenic
1112412947 13:99179553-99179575 GTTTCCAGCCCATGAATACGGGG - Intergenic
1112571386 13:100596690-100596712 TCTACAAGCCAAGGAACACCAGG - Intergenic
1112595822 13:100806009-100806031 GCCGCCAGCTGAGGAACACCTGG - Intergenic
1113129812 13:107023408-107023430 CTTTCCAGCCCAGCAACAGCTGG - Intergenic
1113199927 13:107855700-107855722 AATTCAAACCCAGGAACACCTGG - Intronic
1113209884 13:107964557-107964579 GCTGCAAGCCAAGGAACATCAGG - Intergenic
1113892990 13:113746205-113746227 GCTCCCTGCTCAGGAACACAAGG - Intergenic
1114292212 14:21297586-21297608 CCTTCCAGCCAAGGACCACCAGG + Intronic
1114928497 14:27436363-27436385 CATTGCAGCCCAGGAACACTTGG + Intergenic
1115324671 14:32126374-32126396 GCTGCCAACCATGGAACACCAGG - Intronic
1116166773 14:41343560-41343582 GCTTCCTGCCCTTGAACATCGGG - Intergenic
1118363298 14:65073784-65073806 GCTTCCTGGGCAGGAACACAGGG - Intronic
1118461011 14:65987101-65987123 TGTTACAGCCAAGGAACACCTGG - Intronic
1118708261 14:68499746-68499768 GCCCCAAGCCAAGGAACACCTGG + Intronic
1118921453 14:70153157-70153179 GCAGCAAGCCCAGGGACACCTGG - Intronic
1119516839 14:75254895-75254917 CCTCCAAGCCCAGGATCACCGGG + Intronic
1120269982 14:82299342-82299364 GCCACCAGCCCAGGAAAAGCAGG + Intergenic
1121731803 14:96192643-96192665 CCTTCCAGCTGAGGGACACCTGG + Intergenic
1122087601 14:99318324-99318346 GCTGCCAGCTCAGGACCTCCTGG - Intergenic
1122121853 14:99558743-99558765 GCCACAAGCCAAGGAACACCAGG + Intronic
1122135568 14:99630869-99630891 TCCACAAGCCCAGGAACACCAGG - Intergenic
1122152430 14:99732180-99732202 ACCCTCAGCCCAGGAACACCCGG + Intergenic
1122218220 14:100218361-100218383 GCTTCTAGCCCAGGCCCAGCAGG - Intergenic
1122780769 14:104142522-104142544 GCCTCCAGCCCAGGGAGGCCAGG - Intronic
1124710566 15:32006670-32006692 ACTTCCAGGTCAGGAAGACCAGG + Intergenic
1125105785 15:35969110-35969132 GTTGGCAGCCCAGCAACACCAGG - Intergenic
1128228763 15:66020419-66020441 GCTTCAGGCCCAGCCACACCAGG - Intronic
1129061475 15:72863854-72863876 GCCACAAGCCAAGGAACACCTGG + Intergenic
1129154689 15:73710479-73710501 TCTCCCAGCCCAGGATCCCCTGG - Intronic
1129181998 15:73883460-73883482 GCCACCAGCTGAGGAACACCGGG - Intronic
1129503615 15:76062543-76062565 GCTTCTTGCCCAGTAACATCAGG - Intronic
1131027091 15:89152440-89152462 GCTTGGAGCCCAGGCACCCCAGG + Intronic
1132132135 15:99292210-99292232 GCTTCCAGCAAGGGAAAACCTGG - Intronic
1132269376 15:100510553-100510575 GCCTCCACCCCAGTTACACCTGG + Intronic
1132342416 15:101086870-101086892 GCTTCCACCACATGAGCACCAGG + Intergenic
1132860698 16:2070310-2070332 CCTTCAAACCCAGGACCACCAGG - Intronic
1133248896 16:4467163-4467185 GCCACAAGCCCAGGAACACCTGG + Intronic
1133334462 16:4997802-4997824 GCCACCAGCCAAGGAACACCTGG - Intronic
1133403016 16:5502466-5502488 GCTTCCAGAACAGGGACACTAGG - Intergenic
1133876661 16:9741088-9741110 GCATCCACCCCAGGAACACTTGG + Intergenic
1136272003 16:29153861-29153883 GCCACAAGCCCAGGAATACCTGG - Intergenic
1136604633 16:31325115-31325137 CCTTATAGCCCAGGAACACCCGG - Intronic
1136854557 16:33643995-33644017 GCTTTCAGCCAAGGAGCACTTGG - Intergenic
1137499525 16:48999657-48999679 GCTTCCCGGCCAGGAAAAGCAGG + Intergenic
1137502339 16:49021112-49021134 GTTTCCTGGCCAGGAACAGCGGG + Intergenic
1138239124 16:55412274-55412296 GTTGCAAGCCGAGGAACACCAGG + Intronic
1140718413 16:77748284-77748306 GCCGCGAGCCAAGGAACACCAGG + Intergenic
1141061520 16:80876721-80876743 CCTTCCAGCCCTGAAACACCTGG - Intergenic
1141314533 16:82949260-82949282 GCTACAAGCCAAGGAACACCTGG - Intronic
1141320311 16:83002337-83002359 GCCTCAAGCCAAGAAACACCTGG + Intronic
1141550786 16:84805447-84805469 GCCACAAGCCAAGGAACACCTGG + Intergenic
1141674723 16:85511755-85511777 GCCACAAGCCAAGGAACACCTGG + Intergenic
1141771586 16:86092910-86092932 GCTGCAAGCCCAGGAATACGCGG - Intergenic
1141897304 16:86966255-86966277 GCCACAAGCCGAGGAACACCTGG - Intergenic
1142075607 16:88115847-88115869 GCCACAAGCCCAGGAATACCTGG - Intronic
1142246664 16:88973336-88973358 GGCCACAGCCCAGGAACACCTGG + Intronic
1203116136 16_KI270728v1_random:1492458-1492480 GCTTTCAGCCAAGGAGCACTTGG - Intergenic
1142768007 17:2076494-2076516 GCTTCCTGCCCAGAACCACGGGG - Intronic
1143177746 17:4966357-4966379 GCTTCGAGCCCAGTCATACCTGG + Intronic
1144407130 17:14962860-14962882 GCTTCCAGCCAAAGACCACCAGG - Intergenic
1147324073 17:39662136-39662158 GCTTCCAGCCCAGTCCCAGCTGG + Intronic
1148194392 17:45702731-45702753 GCTTCCAGTCCAGTATCCCCAGG + Intergenic
1150132178 17:62675188-62675210 GTTAACAGCCCAGGATCACCAGG + Intronic
1150304279 17:64071212-64071234 GCACCCTGCTCAGGAACACCCGG - Intronic
1151343152 17:73484731-73484753 GCTGCAAGCCAAGGAACACCTGG - Intronic
1151478687 17:74357508-74357530 GGTTCCAGGCCAGGAACTGCAGG + Exonic
1151844703 17:76644306-76644328 GCTGCCAGCCCAAGAGCACATGG + Intergenic
1151950791 17:77352569-77352591 GCTGCAAGCCGAGGAATACCAGG - Intronic
1152292553 17:79448517-79448539 TCTCCAAGCCAAGGAACACCTGG + Intronic
1152333218 17:79685350-79685372 GGTTCCAGCCCAGGCCCACGTGG + Intergenic
1152385433 17:79971440-79971462 GCTTCCAGACCAGGATGACCTGG - Intronic
1152450051 17:80373048-80373070 GCTTCCGCACCAGGTACACCCGG - Exonic
1152927647 17:83094746-83094768 GCTTCCAGCCAAGGATGCCCTGG + Exonic
1154068034 18:11127549-11127571 GCTTCCTGCCCTCGAACATCAGG + Intronic
1154283336 18:13028117-13028139 GCTACAAGCCAAGGAACACCAGG - Intronic
1156328145 18:36093219-36093241 CCTTCCAGCCAAAGACCACCAGG - Intergenic
1157342012 18:46787285-46787307 CATTACAGCCCAGGAACAGCTGG - Intergenic
1157419901 18:47538391-47538413 GCTTCCAGCAGTGGAACATCAGG + Intergenic
1158808423 18:61002819-61002841 GCTTCCTGTCCTGGAACATCCGG - Intergenic
1158907945 18:62031991-62032013 GCCACAAGCCAAGGAACACCTGG - Intergenic
1159004600 18:63001275-63001297 TCTGCAAGCCAAGGAACACCAGG - Intergenic
1160231488 18:77052782-77052804 CCTGCCAGCCCAGCAACACCGGG + Intronic
1160239562 18:77113331-77113353 GCTACAAGGCCAGGGACACCAGG + Intronic
1160455271 18:78994880-78994902 GCTCCCTGCTCAGGAACAGCAGG - Exonic
1161302911 19:3551556-3551578 GGGTCCAGCCCAGGCCCACCTGG - Intronic
1161511628 19:4675451-4675473 GCTCCCAACCCCGGAACCCCTGG + Exonic
1161597373 19:5157462-5157484 GCCACAAGCCCAGGAACACCTGG - Intergenic
1162067686 19:8136203-8136225 GCTTCCAGGCCACGCCCACCAGG - Exonic
1162524247 19:11197935-11197957 GCTTCCAGCCCTGGGCCGCCTGG - Intergenic
1162885281 19:13692445-13692467 TCTTCCAGCTCAGGAGCACCTGG - Intergenic
1162925094 19:13926869-13926891 GCTTCCAGCCGAGGCTCACCAGG - Exonic
1163067704 19:14811332-14811354 GCTGCAAGGTCAGGAACACCTGG - Intronic
1163332952 19:16653021-16653043 GCTTCCAGCCCAGGTGGAGCAGG + Intronic
1163418092 19:17198804-17198826 GCCACAAGCCAAGGAACACCTGG - Intronic
1164840796 19:31390698-31390720 GCCACAAGCCCAGGAACACCTGG - Intergenic
1166910191 19:46148952-46148974 GCTGAGAGCCCAGGAACTCCAGG - Exonic
1167031980 19:46968426-46968448 GCCTCCAGCCGAGGGACAGCAGG - Intronic
1167272315 19:48512305-48512327 GCTTCCAGCACAGATGCACCCGG + Intronic
1168579500 19:57542749-57542771 TCTTCAAGCCAAGGAACACACGG - Exonic
925027451 2:621084-621106 GCTTCCATCCCCGGAGCACAGGG + Intergenic
925080603 2:1061160-1061182 GCGTCCAACCCAGGATCACGCGG - Intronic
925080612 2:1061239-1061261 GCGTCCAACCCAGGATCACACGG - Intronic
925082803 2:1082944-1082966 GCTTGCTGTCCAGGAACAACAGG + Intronic
925148109 2:1594544-1594566 GCTTCCAGCCCAGGAGCACTGGG - Intergenic
928400829 2:30977630-30977652 GCCTGCAGCCAAGGAACTCCAGG + Intronic
928783207 2:34849819-34849841 GCCACAAGCCAAGGAACACCTGG + Intergenic
929426646 2:41850931-41850953 GCTCCCAGCTCAGGAGCTCCAGG + Intergenic
930130705 2:47847293-47847315 GCTTACAGCCTAGGAACAGTAGG - Intronic
932309102 2:70725630-70725652 GCCACAAGCCAAGGAACACCAGG + Intronic
932560564 2:72863795-72863817 GCTACAAGCCAAGGAACTCCTGG - Intergenic
933761318 2:85674160-85674182 GCTGCAAGCTCAGGAACACTAGG + Intergenic
935408509 2:102735291-102735313 GCTGCAAGCCCAGAAACACAAGG - Intronic
936403850 2:112185379-112185401 GCATCCAGCCCAGCCACACTTGG - Intronic
936462759 2:112724452-112724474 GCTGCCTGCCCAGTGACACCTGG - Intronic
936518017 2:113194303-113194325 AATTCAAACCCAGGAACACCAGG - Intronic
937454312 2:122028046-122028068 GCATGCAGCCCGGGACCACCTGG + Intergenic
937887619 2:126910877-126910899 GCCTGCAGCTCAGGAACACCAGG + Intergenic
937966537 2:127515857-127515879 GCTTCCTTCCCAGGAAGAGCAGG + Intronic
938062214 2:128262758-128262780 GCTTCCAGCCTAGGAGGACTCGG - Intronic
938790016 2:134668319-134668341 CCTTCCAGCCCCTCAACACCGGG - Intronic
938968080 2:136406328-136406350 GCCCTCAGCCCAGGAAGACCAGG + Intergenic
941314054 2:163970158-163970180 GCCACAAGCCAAGGAACACCAGG - Intergenic
942406248 2:175659680-175659702 GCTACAAGCCATGGAACACCTGG + Intergenic
942925077 2:181421935-181421957 GTTTCAAGCCAAGGAACACCAGG + Intergenic
943101590 2:183493256-183493278 GCTTCCTTCCCAGGAAGAGCAGG - Intergenic
944080557 2:195783450-195783472 GCCACAAGCCAAGGAACACCTGG - Intronic
944543756 2:200779069-200779091 ACTGTCAGCCCAGGAACACCAGG + Intergenic
946078410 2:217095488-217095510 GCTGCAAGTCAAGGAACACCAGG + Intergenic
948131021 2:235600631-235600653 GCTTCCTGCCCTCGAACATCAGG - Intronic
948504872 2:238421955-238421977 GCCACAAGCCGAGGAACACCTGG - Intergenic
948803318 2:240442489-240442511 TTTACCAGCCAAGGAACACCTGG - Intronic
948850591 2:240703613-240703635 GCTCCCAGCCCAGGAAAGCAAGG - Intergenic
1168807499 20:681114-681136 CCTTCCTGCCCAGGAGCCCCAGG + Intergenic
1169927933 20:10802435-10802457 GCTGCAAGCCAAGGAATACCAGG - Intergenic
1171183826 20:23110792-23110814 GCCACAAGCCCAGGGACACCTGG - Intergenic
1171519505 20:25765141-25765163 GCTACCAGGCAAGGAACACTGGG + Intronic
1171557415 20:26091352-26091374 GCTACCAGGCAAGGAACACTGGG - Intergenic
1172731250 20:37090200-37090222 GTTTGCAGCCCAGGAGCAACAGG + Intronic
1172767330 20:37357854-37357876 GCTGCCAGTGCAGGAACAGCAGG + Intronic
1173685936 20:44923709-44923731 CCTGCCAGCCCAGGAACCTCGGG - Intronic
1174042379 20:47709103-47709125 TCTCCCAGCCCAGGAGCCCCGGG - Intronic
1174401886 20:50280439-50280461 GATTCCAGCCCAGGACCATGTGG + Intergenic
1174548516 20:51344443-51344465 GCTTCAAGCCAAGGAACCCCAGG + Intergenic
1175183831 20:57166640-57166662 GCCACGGGCCCAGGAACACCTGG + Intergenic
1175183950 20:57167255-57167277 GATTCCAGCTCAGGAAAGCCTGG + Intergenic
1175821150 20:61909579-61909601 ACCACAAGCCCAGGAACACCAGG - Intronic
1176064340 20:63187015-63187037 TCTTCCATCCCAGGAAGGCCAGG + Intergenic
1176199546 20:63854276-63854298 GTCCCCAGCCCAGGCACACCTGG + Intergenic
1176288732 21:5033329-5033351 GCTGAGAGCTCAGGAACACCAGG + Intronic
1176296754 21:5077042-5077064 GCTTCCACCCCAGTACCCCCAGG + Intergenic
1177279462 21:18961950-18961972 GCCTGGAGCCCAGGATCACCAGG - Intergenic
1178011593 21:28292760-28292782 GCTTCCAGTACATAAACACCTGG - Intergenic
1178905645 21:36633760-36633782 GCTACCAGCCCAAGACCACCAGG + Intergenic
1179031794 21:37727091-37727113 GTCTCAAGCCAAGGAACACCCGG + Intronic
1179032195 21:37730331-37730353 GATTCCAACCCAGGCCCACCAGG - Intronic
1179295586 21:40059493-40059515 GCTGCCAGGCCAGGAATCCCTGG + Intronic
1179593837 21:42429134-42429156 GCCACAAGCCAAGGAACACCTGG + Intronic
1179860295 21:44185079-44185101 GCTTCCACCCCAGTACCCCCAGG - Intergenic
1179868452 21:44230146-44230168 GCTGAGAGCTCAGGAACACCAGG - Intronic
1179982143 21:44901148-44901170 GGTTCCACCCCAGGAACCACGGG + Intronic
1180075653 21:45460196-45460218 GCTCCCAGCCGGGGAGCACCAGG + Intronic
1180765841 22:18345490-18345512 GCCTCCAGCCCAGGATGCCCTGG - Intergenic
1180780470 22:18516888-18516910 GCCTCCAGCCCAGGATGCCCTGG + Intronic
1180813188 22:18774209-18774231 GCCTCCAGCCCAGGATGCCCTGG + Intergenic
1180889269 22:19273931-19273953 CCTTCCAGCCAAAGACCACCAGG - Intronic
1180940563 22:19657578-19657600 GCCCCCACCCCATGAACACCAGG - Intergenic
1181199363 22:21208525-21208547 GCCTCCAGCCCAGGATGCCCTGG + Intronic
1181400395 22:22647332-22647354 GCCTCCAGCCCAGGATGCCCTGG - Intronic
1181573166 22:23778824-23778846 GCTTCCTCCGAAGGAACACCAGG - Intronic
1181622666 22:24101716-24101738 GCTTCCTGACCAGGAAAACGAGG + Intronic
1181648970 22:24248459-24248481 GCCTCCAGCCCAGGATGCCCTGG + Intergenic
1181702374 22:24628430-24628452 GCCTCCAGCCCAGGATGCCCTGG - Intronic
1181776707 22:25165375-25165397 GCTTCCAGAGCCAGAACACCTGG - Intronic
1182427408 22:30282157-30282179 GTTTGCAGCCCAGGAGCAACAGG + Intergenic
1184743060 22:46440221-46440243 GCGGCCAGTCCAGGAACAACTGG - Intronic
1184854107 22:47137109-47137131 ACTTCCAGTCCAGGAAGCCCTGG + Intronic
1185009559 22:48305585-48305607 CCTGCCAGCCCAGGTACACCTGG - Intergenic
1185082049 22:48714896-48714918 GCCACGAGCCAAGGAACACCTGG - Intronic
1185222796 22:49637354-49637376 GCTGCCAGCACAGGAGCACACGG + Intronic
1203227462 22_KI270731v1_random:86381-86403 GCCTCCAGCCCAGGATGCCCTGG - Intergenic
949411733 3:3773086-3773108 GCTGCCAGCCAAGGAACCCCGGG - Intronic
950221015 3:11196135-11196157 GCCTCCAGCCTAAGAACACCAGG - Intronic
951035934 3:17931843-17931865 GCCACAAGCCAAGGAACACCAGG - Intronic
951429263 3:22587075-22587097 GCTACAAGCCAAGGAACACCTGG - Intergenic
951444640 3:22764465-22764487 GCTGCCTGACCTGGAACACCTGG + Intergenic
952522883 3:34179731-34179753 GCTACCAGCCAAGGAATGCCAGG + Intergenic
953198257 3:40754144-40754166 GCTTCCTGGCCAGAAACTCCTGG + Intergenic
954975889 3:54694266-54694288 GTTTGCAGCCTAGGAACACTGGG + Intronic
955908080 3:63828843-63828865 GTTTCAAACCCAGGAACACCTGG + Intronic
956077098 3:65517068-65517090 GCTTCCAGAGTAGGAAAACCTGG - Intronic
957835099 3:85577238-85577260 GCTTCCAACACATGAACTCCGGG - Intronic
959535662 3:107482309-107482331 CCTTCCAGCCAAGGAACACCAGG - Intergenic
960517143 3:118614952-118614974 GCTACAAGCCAAGGAATACCAGG + Intergenic
961440039 3:126947310-126947332 GCTCCCAGCCCAGGAGCCACAGG - Intronic
961754554 3:129120468-129120490 GCCTTCAGCCCAGGATCTCCTGG + Intronic
963593524 3:147295159-147295181 GCTTCCAGCACAGAAACAAATGG - Intergenic
965392480 3:168121623-168121645 GCTGCAAGCCAAGGAACACTAGG - Intergenic
967952249 3:194850444-194850466 GCTTCCAGGACAGGAAAGCCTGG + Intergenic
968729813 4:2264418-2264440 GGTTTGAGCCCAGGGACACCAGG - Intergenic
968984835 4:3869442-3869464 GCCACAAGCCCAGGAACACCTGG - Intergenic
969205215 4:5638822-5638844 GTTACAACCCCAGGAACACCCGG + Intronic
969317644 4:6391599-6391621 GCCTCCACCCCAAGAGCACCAGG + Intronic
969513000 4:7630261-7630283 GCTTGAATCCCAGGAGCACCTGG + Intronic
969871581 4:10107991-10108013 GCATCCTGCCCAGGAATAGCTGG + Intronic
970428312 4:15965287-15965309 GCTTCCAACTCAGGAGCCCCTGG + Intronic
972254682 4:37340544-37340566 GCTTGCAGCCCAGGAAATACAGG + Intronic
974569385 4:63625507-63625529 TCTTCCAGCAGAGGAAAACCTGG + Intergenic
975852047 4:78582460-78582482 TCTTCCAGCCCAGGAACATTTGG - Intronic
980103859 4:128568076-128568098 GCCACAAGCCAAGGAACACCTGG - Intergenic
981568555 4:146127230-146127252 GCTTCTAGCCTAGGAACAATAGG + Intergenic
982222851 4:153139811-153139833 GCTTCCTGCCCTCGAACATCAGG + Intergenic
982693958 4:158579119-158579141 GCCACAAGCCAAGGAACACCAGG + Intronic
982927703 4:161360002-161360024 GCTGCAAGCCCAGGAACAATGGG - Intergenic
985971264 5:3380586-3380608 GCCACAAGCCCAGGAGCACCTGG + Intergenic
986002304 5:3639799-3639821 GCTGCAAGCCCAGGATCACGGGG - Intergenic
986233184 5:5885486-5885508 GCCTCCAGCCCTGGAGCAGCTGG + Intergenic
986547304 5:8912427-8912449 GCTTCCTGCCCTAGAACATCAGG - Intergenic
986572490 5:9180030-9180052 AATGCAAGCCCAGGAACACCTGG - Intronic
986649653 5:9950364-9950386 GCTATGAGCCAAGGAACACCTGG + Intergenic
987179103 5:15347819-15347841 GCTACAGGCCAAGGAACACCAGG + Intergenic
987268601 5:16281261-16281283 CCTGCAAGCCCAGGAACCCCAGG - Intergenic
987911658 5:24154882-24154904 GATACCAGCCCAGCAACAGCAGG + Intronic
987948944 5:24651586-24651608 TCCTTCACCCCAGGAACACCAGG + Intergenic
988239105 5:28585739-28585761 ACATCCAGCCGAGGTACACCTGG + Intergenic
990989648 5:61672671-61672693 GCTTACAGTTCAGGACCACCTGG - Intronic
991361258 5:65822965-65822987 GTTTCCAGGCCAGTAACACATGG - Exonic
991912364 5:71574470-71574492 TCCTTCACCCCAGGAACACCAGG + Intergenic
995016725 5:107318340-107318362 GCCACAAACCCAGGAACACCTGG + Intergenic
995480922 5:112591920-112591942 GCCACCAGCCAAGGAACACCAGG - Intergenic
996785254 5:127230353-127230375 GCTTCAAGCCTGGGGACACCGGG - Intergenic
997358554 5:133279963-133279985 GCTGCAAGCCAAGGAATACCAGG + Intronic
997385476 5:133468721-133468743 GGTTGCAGCACAGGAACAACTGG - Intronic
1000024425 5:157346519-157346541 GCCATCAGCCAAGGAACACCGGG + Intronic
1000621360 5:163489803-163489825 GCTTCCCTCCCAGGAGGACCAGG - Intronic
1000765771 5:165286831-165286853 GCACCCAGCCTAGGAACACTGGG + Intergenic
1001243994 5:170092115-170092137 GCTGCAAGCCAAGTAACACCAGG - Intergenic
1002698697 5:181107577-181107599 GCCTCCAGCCAAAGACCACCAGG + Intergenic
1003443242 6:6162559-6162581 GCTTCCAAGTCAGGAAGACCTGG + Intronic
1004295156 6:14403357-14403379 CCTACAAGCCGAGGAACACCAGG - Intergenic
1004465495 6:15881381-15881403 TCTACAAGCCCAGGAACACCAGG + Intergenic
1006899906 6:37493271-37493293 CCTTCCGGCCCAGGGACAGCTGG - Intronic
1007246826 6:40469184-40469206 GCCACAAGCCAAGGAACACCCGG + Intronic
1007604273 6:43105736-43105758 GCTACAAGCCAAGGAGCACCAGG + Intronic
1007700458 6:43763311-43763333 GCTTCCAGCCCAGGCCCAGGGGG + Intergenic
1007706145 6:43792607-43792629 GCTTCCAGCCCCAGGACAGCTGG - Intergenic
1007748562 6:44057919-44057941 GCTTCCAGTTCAGGAACATTAGG + Intergenic
1008593939 6:53022463-53022485 GCTTACAGTCTAGGAACAACAGG + Intronic
1009336309 6:62494498-62494520 GCACCCAACACAGGAACACCCGG + Intergenic
1011096974 6:83676996-83677018 GCTTGCAGCCCCTGAACAACTGG + Intronic
1013116235 6:107105782-107105804 GGTGCCAGTCCAGGAAGACCTGG + Intronic
1013418744 6:109947426-109947448 CCTTCCATCCCAGAAATACCAGG + Intergenic
1013795902 6:113888551-113888573 GGTCCCAGTCCAGGAACATCAGG + Intergenic
1014498968 6:122163075-122163097 GCTTCCTGCCCTTGAACATCAGG - Intergenic
1016575934 6:145569981-145570003 GCTTCCTGCCCTCGAACATCGGG - Intronic
1017709719 6:157156729-157156751 GCTTCCACACCAGAACCACCAGG - Intronic
1018180817 6:161221766-161221788 CCTGCAAGCCAAGGAACACCTGG - Intronic
1018826804 6:167414223-167414245 GCTTACAGCCCGGGAGCAACAGG + Intergenic
1019220723 6:170470486-170470508 GCTACCAGTCCAGGAATCCCAGG - Intergenic
1019560042 7:1651381-1651403 GCTGCCACCCCAGGCACACACGG + Intergenic
1022306335 7:29149740-29149762 GCCACAAGCCAAGGAACACCTGG - Intronic
1023845605 7:44118362-44118384 GCCACAAGCCCAGGAACACCAGG + Intronic
1023868825 7:44252001-44252023 GCTGCCAGGCCAGGCACCCCAGG + Intronic
1023892176 7:44400725-44400747 CCACCAAGCCCAGGAACACCTGG - Intronic
1023997424 7:45169632-45169654 ACTGCAAGCCAAGGAACACCTGG - Intronic
1024627896 7:51224093-51224115 GTTTGCAGCCCAGGAACAATAGG + Intronic
1027850260 7:83442758-83442780 GGTTCCTGGCCAGGAACATCAGG - Intronic
1028528741 7:91814712-91814734 GCTGCAAGCCAAGGAACACCTGG + Intronic
1028857462 7:95607850-95607872 GCCCCCAGCCCAGTAACAACAGG - Intergenic
1029060962 7:97797632-97797654 GTTACCAACCCAGGAAGACCTGG + Intergenic
1029239147 7:99146187-99146209 GTTTCCAGGTCAGGAACACCTGG - Intergenic
1029544598 7:101203558-101203580 TCTTCCAGCCCAGGTGCACCTGG - Intergenic
1029815808 7:103093643-103093665 ACTTCCAGCCCCTGAACCCCTGG + Intronic
1031549430 7:123090071-123090093 GCTTCCAGAAGAGGAACATCTGG - Intergenic
1031917095 7:127574011-127574033 GCTTACAGCCTAGGAGCACCAGG + Intergenic
1033235743 7:139636607-139636629 GCCACAAGCCAAGGAACACCTGG + Intronic
1034945671 7:155260278-155260300 GATCCCAGCCCAGGAGAACCTGG + Intergenic
1035299053 7:157885329-157885351 GCCCCCAGCCCAGGCCCACCTGG - Intronic
1037209148 8:16363891-16363913 GCCACAAGCCAAGGAACACCTGG + Intronic
1038310734 8:26444406-26444428 TCTACAGGCCCAGGAACACCAGG - Intronic
1039455733 8:37704836-37704858 GCCACCATCCCAGGAAAACCTGG - Intergenic
1042231466 8:66559330-66559352 CCTTCCCGCCCAGGACCACCAGG + Intergenic
1044338223 8:91015044-91015066 GCTTGTGGACCAGGAACACCAGG + Intronic
1044610681 8:94088868-94088890 GCTACGAGCCAAGGAACTCCAGG - Intergenic
1044935986 8:97293790-97293812 GCTCCCTGCCCAGGATCACCAGG + Intergenic
1045176912 8:99735491-99735513 ACTACAAGCCAAGGAACACCTGG + Intronic
1046389208 8:113546228-113546250 CCTTCCAGCCAAAGACCACCAGG - Intergenic
1047217793 8:122892094-122892116 GCACTCAGCACAGGAACACCCGG - Intronic
1047284212 8:123472536-123472558 GCTGCAAGCCAAGGAACACCAGG - Intergenic
1047820537 8:128514966-128514988 GCTCCCTGCCCAGAAACACAAGG + Intergenic
1048217911 8:132513668-132513690 GCTGCAAGCCCAGGAATGCCAGG + Intergenic
1049242105 8:141543340-141543362 TCCCCCAGCCAAGGAACACCAGG + Intergenic
1049363622 8:142225938-142225960 GCCACCAGCCTAGAAACACCTGG - Intronic
1049602864 8:143515976-143515998 GCTTCCAGCCCAGGCCCTGCAGG + Intronic
1049776049 8:144405677-144405699 GCCTCCAGCCCAGATTCACCTGG - Intronic
1051345353 9:16146309-16146331 TGTTCCAGCCCAGAAACACATGG + Intergenic
1051742451 9:20264988-20265010 GCTCCCAGCCCTGGTACATCTGG + Intergenic
1056811193 9:89765362-89765384 GCTGACAGCCCAGGTATACCAGG - Intergenic
1059068160 9:111106680-111106702 GCCACAAGCCAAGGAACACCAGG - Intergenic
1059641377 9:116219998-116220020 GCTGCCAGCCCTGGTAGACCAGG - Exonic
1059964487 9:119600385-119600407 GCTACAAGCCAAGGAACATCAGG - Intergenic
1060533811 9:124366852-124366874 GCTTGCAGCCCAGGAGCAACAGG + Intronic
1060621043 9:125066914-125066936 GATTGCAGCCCAGGAGCAACAGG + Intronic
1061016165 9:127981797-127981819 GCTCCCAGCTCAAGACCACCAGG + Intergenic
1061032133 9:128091748-128091770 GCTTCCAGCCTGAGAACCCCAGG + Intronic
1061326978 9:129869889-129869911 GTCTCCCGCCCAGGAAAACCAGG - Intronic
1061894078 9:133637908-133637930 GGTTCCAGCCAAGAAAGACCTGG + Intronic
1062408467 9:136409555-136409577 GCTTTCAGACCACGGACACCAGG - Intronic
1185455872 X:310678-310700 GCCTCAAGCCCAGGGACGCCTGG + Intronic
1185485043 X:475666-475688 GCCACAAGCCCAGGGACACCTGG - Intergenic
1185499774 X:587902-587924 GCCACAAGCCCAGGGACACCTGG - Intergenic
1185543932 X:926570-926592 GCCACAAGCCCAGGGACACCTGG - Intergenic
1185579879 X:1203635-1203657 GCCACAAGCCCAGGGACACCTGG + Intronic
1185614774 X:1414163-1414185 GCTACAAGCCCAGGGACACCCGG + Intronic
1185622725 X:1463411-1463433 GCCACAAGCCCAGGGACACCTGG - Exonic
1185650457 X:1644086-1644108 GCCACAAGCCCAGGGACACCTGG + Intergenic
1185653425 X:1665769-1665791 GCCACAAGCCCAGGGACACCTGG - Intergenic
1185653526 X:1666442-1666464 GCCACAAGCCCAGGGACACCTGG - Intergenic
1185677395 X:1859868-1859890 GCCACAAGCCCAGGGACACCTGG - Intergenic
1185754460 X:2642375-2642397 GCCACAAGCCCAGGAACACCTGG - Intergenic
1185822798 X:3220732-3220754 GCCACAAGCCCAGGGACACCTGG - Intergenic
1185888198 X:3801814-3801836 GCAGCAAGCCCAGGGACACCGGG + Intergenic
1185895343 X:3853665-3853687 GCCACAAGCCCAGGGACACCTGG + Intergenic
1185900460 X:3892089-3892111 GCCACAAGCCCAGGGACACCTGG + Intergenic
1185905576 X:3930520-3930542 GCCACAAGCCCAGGGACACCTGG + Intergenic
1186129953 X:6455752-6455774 GCTTCCTGCCCTCGAACATCAGG - Intergenic
1186138852 X:6549478-6549500 GCCACAAGCCCAGGGACACCTGG + Intergenic
1186500489 X:10046828-10046850 GAGTCCAGCTCAGGAACACCTGG + Intronic
1186897010 X:14013669-14013691 GCCACAAGCCAAGGAACACCAGG + Intronic
1186907835 X:14130951-14130973 GCTACAAGCCAAGGAATACCTGG - Intergenic
1189345701 X:40239769-40239791 GCTTCCCGTGCAGGAACAGCAGG + Intergenic
1189729732 X:44006722-44006744 TCTTCCAGTCCATGAACACAGGG - Intergenic
1190643224 X:52501077-52501099 GCCTCCAGCCCAGGAGGTCCAGG + Intergenic
1190644448 X:52511790-52511812 GCCTCCAGCCCAGGAGGTCCAGG - Intergenic
1192017448 X:67346953-67346975 GCTGACAGCCCAGGGTCACCTGG + Intergenic
1192316906 X:70060296-70060318 TCTTCCAGTCCTTGAACACCTGG - Intergenic
1195547339 X:106127080-106127102 GCTTCCGGCCCTCGAACATCGGG - Intergenic
1197490680 X:127113214-127113236 CCTTCAGTCCCAGGAACACCAGG + Intergenic
1197673351 X:129303023-129303045 GGTTCAAGCCCAGCAAGACCAGG + Intergenic
1198565183 X:137896875-137896897 GCTTCCTGCCCTCGAACATCAGG + Intergenic
1199607451 X:149587266-149587288 GCTCCCAGCCCTGGACCACCCGG - Intronic
1199613472 X:149636874-149636896 GCCACAAGCCAAGGAACACCTGG + Intergenic
1199615578 X:149652495-149652517 GCTGCCAGCCCTGGGCCACCTGG - Intergenic
1199631672 X:149782101-149782123 GCTCCCAGCCCTGGACCACCCGG + Intronic
1199634836 X:149805302-149805324 GCTGCCAGCCCTGGACCACCTGG + Intergenic
1199642920 X:149881359-149881381 GCTGCCAGCCCTGGACCACCAGG + Intronic
1199874842 X:151921420-151921442 GCTGCCAGTCCTGGACCACCCGG + Intronic
1199947335 X:152679898-152679920 GCTGCCAACCCAGGACCACCCGG + Intergenic
1199962345 X:152788556-152788578 GCTGCCAACCCAGGACCACCCGG - Intergenic
1199968804 X:152843501-152843523 GCTACAAGCAAAGGAACACCTGG - Intronic
1200017944 X:153180125-153180147 GCTGCCAGCCCTGGACCACCCGG + Intronic
1200050964 X:153431544-153431566 GCCACAAGCCAAGGAACACCCGG + Intergenic
1200061096 X:153484122-153484144 GCCACAAGCCCAGGAACACCTGG - Intronic
1200134510 X:153868346-153868368 CCTTGCAGCCCAGCATCACCTGG - Exonic
1201714288 Y:17027226-17027248 GCTGCAAATCCAGGAACACCAGG - Intergenic