ID: 1077730330

View in Genome Browser
Species Human (GRCh38)
Location 11:4723118-4723140
Sequence CAGCTCGGACAGCTTGGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 10, 2: 14, 3: 28, 4: 129}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077730318_1077730330 28 Left 1077730318 11:4723067-4723089 CCCATGCAGCTGTCACGGCATGT 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1077730330 11:4723118-4723140 CAGCTCGGACAGCTTGGAGTTGG 0: 1
1: 10
2: 14
3: 28
4: 129
1077730324_1077730330 -4 Left 1077730324 11:4723099-4723121 CCCGCTGCAGGGCGGCCTCCAGC 0: 12
1: 16
2: 20
3: 49
4: 391
Right 1077730330 11:4723118-4723140 CAGCTCGGACAGCTTGGAGTTGG 0: 1
1: 10
2: 14
3: 28
4: 129
1077730319_1077730330 27 Left 1077730319 11:4723068-4723090 CCATGCAGCTGTCACGGCATGTT 0: 1
1: 0
2: 1
3: 7
4: 104
Right 1077730330 11:4723118-4723140 CAGCTCGGACAGCTTGGAGTTGG 0: 1
1: 10
2: 14
3: 28
4: 129
1077730325_1077730330 -5 Left 1077730325 11:4723100-4723122 CCGCTGCAGGGCGGCCTCCAGCT 0: 12
1: 14
2: 7
3: 33
4: 301
Right 1077730330 11:4723118-4723140 CAGCTCGGACAGCTTGGAGTTGG 0: 1
1: 10
2: 14
3: 28
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077730330 Original CRISPR CAGCTCGGACAGCTTGGAGT TGG Intronic
900892290 1:5458271-5458293 CAGCTCTGATAGCTTGAAGCTGG - Intergenic
901301042 1:8200345-8200367 CAGCTGGGACAGGTTGGAAAGGG + Intergenic
901590127 1:10334191-10334213 CTGCTCGGGCAGGTTGGAGGAGG - Intronic
903364897 1:22800078-22800100 CAGCTCTGACAGCAGGGTGTGGG - Intronic
904462993 1:30691466-30691488 CAGCTAGGAAAGCATGGAGGTGG - Intergenic
904878815 1:33678662-33678684 CAGCTCGGTCAGCTTAGAGGGGG - Intronic
906223701 1:44103709-44103731 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
907059309 1:51405109-51405131 CAGTTAGGACAGTTTGGAGGGGG - Intronic
908698831 1:66875583-66875605 CAGCTGGGAGAGTTTGGAATTGG + Intronic
909232283 1:73105878-73105900 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
912863188 1:113233120-113233142 CAGCAAGTACAGATTGGAGTTGG + Intergenic
914932817 1:151949895-151949917 CAGCTCTGCCAGCGTGGCGTTGG + Intergenic
915619812 1:157074298-157074320 CAGCTCGGACAACTTGGCGTTGG - Intergenic
919687056 1:200493567-200493589 CAGCTGTGACAGCTGGGAGCAGG + Intergenic
919701349 1:200634499-200634521 AAGCTAGGACAGCTAGGATTTGG - Intronic
922213131 1:223500518-223500540 CAGCTTGCACAGCTGGGAGCAGG - Intergenic
922597267 1:226823696-226823718 CAGGTGAGACGGCTTGGAGTAGG - Intergenic
924698057 1:246420336-246420358 CTGCTCCTACAGCTTGGGGTTGG + Intronic
1063714539 10:8514070-8514092 CAGCTCAGACACCTTGGTGTTGG + Intergenic
1064302069 10:14131789-14131811 CAGCTAGGACAGCTTCTAGCGGG - Intronic
1068044707 10:51871541-51871563 CAGCACTGACAGCTTGGGGCTGG - Intronic
1069554091 10:69385483-69385505 CAGCCCTGACAGCATGGAGCTGG - Intronic
1072379985 10:94858179-94858201 CAGCTGGGAAAGCTTGAACTGGG - Intergenic
1072717647 10:97762304-97762326 CAGCTCCCACAGCCTGGCGTGGG + Intergenic
1075438554 10:122462026-122462048 CAGCTGGCACAGGTTGGCGTAGG - Exonic
1076408460 10:130229633-130229655 AAGGTCGGACATCTTGAAGTGGG + Intergenic
1077108317 11:851336-851358 CAGCTCCTGCAGCTGGGAGTCGG + Intronic
1077341818 11:2029612-2029634 CAGCTCTGCCTGCTTGGAGTTGG + Intergenic
1077421538 11:2452429-2452451 CAGCCCGGGCAGCTTAGAGGAGG + Intronic
1077730330 11:4723118-4723140 CAGCTCGGACAGCTTGGAGTTGG + Intronic
1077984815 11:7341221-7341243 CACCTCGGACTCCTTTGAGTTGG + Intronic
1078077246 11:8173263-8173285 GAGCTGGGGCAGCTTGGAGTGGG + Intergenic
1081182382 11:39999872-39999894 GAGGTGGGACAACTTGGAGTGGG - Intergenic
1081965724 11:47168221-47168243 CATCTCAGACAGCACGGAGTGGG + Exonic
1082761513 11:57131297-57131319 CAGCCTGGACACCTTGGAGCAGG + Intergenic
1089599225 11:119603238-119603260 CAGCTCCGACAGCTCGGCGTTGG + Intergenic
1089796633 11:120986206-120986228 CAGCGAGGAGAGCCTGGAGTGGG + Exonic
1091226217 11:133957710-133957732 CAACTTTGACTGCTTGGAGTCGG - Intergenic
1202824804 11_KI270721v1_random:84801-84823 CAGCTCTGCCTGCTTGGAGTTGG + Intergenic
1096518728 12:52172332-52172354 CAGCTGGGCCAGCTTGGTCTTGG + Exonic
1096532779 12:52252395-52252417 CAGCTCGGCCAGCTTGCAGCGGG + Intronic
1096537935 12:52287236-52287258 CAGCTCGGCCAGCTTGCAGCGGG + Exonic
1096540836 12:52306124-52306146 CAGCTCGGCCAACTTGCAGCGGG - Exonic
1096542534 12:52316027-52316049 CAGCTCGGCCAGCTTGCAGCGGG + Exonic
1096547411 12:52350177-52350199 CAGCTCAGCCAGCTTGCAGTGGG - Intergenic
1096549400 12:52362385-52362407 CAGCTCAGCCAGCTTGCAGCGGG + Exonic
1096626435 12:52898813-52898835 CAGCTCGGACAACTTGGCGTTGG + Exonic
1096757078 12:53808610-53808632 CAGCTGGGAAAACTTGGAGCCGG + Intergenic
1096785361 12:54014279-54014301 CAGCTGGGGCAGCTTTGAGCAGG + Intronic
1097149743 12:56967934-56967956 CATCTCCCACAGCTTGGAGGGGG + Intergenic
1097615571 12:61880368-61880390 CAGCTCCAACAGCTTGGTGTTGG - Intronic
1098264703 12:68706675-68706697 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1100244144 12:92739520-92739542 AAGCTTGGACAGCTTACAGTGGG - Intronic
1101233276 12:102763723-102763745 AGGCTCAGACAGCTTGGAGTGGG + Intergenic
1103937383 12:124483722-124483744 CAGCTCGGGCAGGTATGAGTGGG + Exonic
1110834466 13:80067559-80067581 AAGTTCGCACAGCTTAGAGTTGG + Intergenic
1115951625 14:38728077-38728099 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
1116326902 14:43541259-43541281 CAGCTCGGACAGCTTGGCCTTGG + Intergenic
1122354839 14:101116636-101116658 GAGCTTGGAGTGCTTGGAGTGGG - Intergenic
1122834466 14:104424113-104424135 CAGCTAGGACAGCAAGGAATGGG - Intergenic
1125841030 15:42801347-42801369 CAGCTCAGACAGCTTGGCATTGG + Intronic
1126467319 15:48972950-48972972 CAGCTCGGACAGCTTAGTCTTGG - Intergenic
1127670265 15:61188116-61188138 AAGCCCAGACAGCTTGGGGTTGG - Intronic
1128842243 15:70859758-70859780 CAGCTCGGACAGCTTGGCGTTGG - Intronic
1129121422 15:73399147-73399169 CAGCAAGCACTGCTTGGAGTAGG + Intergenic
1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG + Intergenic
1131133463 15:89914600-89914622 CAGGTAGGCCAGCTAGGAGTGGG - Intergenic
1132201448 15:99957060-99957082 GAGCTGGGAGAGCTTTGAGTAGG + Intergenic
1132478463 16:154035-154057 CAGCTCGCTCAGCTTGGACAGGG - Exonic
1132480548 16:164625-164647 CAGCTCGCTCAGCTTGGACAGGG - Intronic
1133708140 16:8375293-8375315 CAGCTCCGAGAGGTGGGAGTAGG + Intergenic
1133823267 16:9255854-9255876 CAGCTCTGCCACCTTGGAATTGG + Intergenic
1136153592 16:28367878-28367900 CAGCCCGGACCGCATGGACTCGG + Intergenic
1136209495 16:28747389-28747411 CAGCCCGGACCGCATGGACTCGG - Intergenic
1136389164 16:29951464-29951486 CAGCTCGGACACAGTGGGGTAGG - Intronic
1136713076 16:32255776-32255798 CATCTTGGACATCTTGGAGATGG + Exonic
1136754838 16:32673652-32673674 CATCTTGGACATCTTGGAGATGG - Exonic
1136813274 16:33196712-33196734 CATCTTGGACATCTTGGAGATGG + Exonic
1136819750 16:33306792-33306814 CATCTTGGACATCTTGGAGATGG + Intronic
1136826314 16:33363332-33363354 CATCTTGGACATCTTGGAGATGG + Exonic
1136831380 16:33462103-33462125 CATCTTGGACATCTTGGAGATGG + Exonic
1137613999 16:49836300-49836322 CAGCTTGGACAGGTTGGAGGTGG - Intronic
1138503604 16:57464526-57464548 CAGCTCAGAGAGTTTGGATTAGG + Intronic
1139576644 16:67846556-67846578 CAGCTGGGCCAGCTTGGGGCCGG + Intronic
1140753718 16:78048831-78048853 CAGCTTGGACAGCTTGGCGTTGG + Intronic
1141102779 16:81210219-81210241 CAGCCCTGACACCTTGGTGTCGG - Intergenic
1141461931 16:84182949-84182971 CAGCTCAGACTGCATGGAGCAGG + Intronic
1141922971 16:87148382-87148404 CAGCTTTGCCAGCATGGAGTTGG + Intronic
1202991851 16_KI270728v1_random:19687-19709 CATCTTGGACATCTTGGAGATGG + Intergenic
1203056980 16_KI270728v1_random:933986-934008 CATCTTGGACATCTTGGAGATGG - Intergenic
1143410725 17:6706854-6706876 CTTCAGGGACAGCTTGGAGTGGG + Intronic
1144092285 17:11868866-11868888 CAGCTCTCTCATCTTGGAGTAGG + Intronic
1150002747 17:61451922-61451944 CAGCGCGCACAGCTGGGAGCAGG + Intergenic
1152841313 17:82570521-82570543 CAGCGCTGACAGCTCAGAGTGGG - Intronic
1155570317 18:27185275-27185297 GAGCGGGGACAGCTCGGAGTCGG + Exonic
1157063555 18:44321169-44321191 CAGCTCGGACAGCTTGGTGTTGG + Intergenic
927787071 2:25981699-25981721 CAGGTCGGCCTGCTTGGAGCTGG + Exonic
927948253 2:27150223-27150245 CAACTTGGAGAGCTTGGTGTCGG - Exonic
928730352 2:34224740-34224762 GAGCTCGGAGAGTTTGGAGTAGG + Intergenic
938716877 2:134028913-134028935 CTTCTCTGAAAGCTTGGAGTTGG - Intergenic
939806112 2:146777421-146777443 CAGCTCTAACAGCTTGCATTTGG - Intergenic
940690006 2:156904678-156904700 CAGGTTGGACAGCTTGGATTGGG + Intergenic
942558646 2:177198147-177198169 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
943064431 2:183071424-183071446 CAGCTCAGACAGCTTGGCGCTGG + Intergenic
944580414 2:201127304-201127326 CAGCTCAGGCAGGGTGGAGTTGG + Intronic
944763445 2:202840715-202840737 CAGCTCGGAGAGCTTGGCATTGG + Intronic
946320879 2:218953774-218953796 CAGCTCAGACAGCTTGGTGTTGG + Intergenic
947586160 2:231358203-231358225 CAGCAGGGACAGCAGGGAGTGGG + Intronic
1171416426 20:24984127-24984149 GAGGTCGGCCAGCTTGCAGTGGG - Intronic
1174601914 20:51731837-51731859 CAGCTGTGACAGCATGGGGTGGG - Intronic
1177960546 21:27660848-27660870 CAGCTCTGACTGGTAGGAGTTGG - Intergenic
1178991281 21:37358641-37358663 CAGCACGGGCAGGATGGAGTAGG - Intergenic
1181517791 22:23425643-23425665 CAGCTCGGATCCCCTGGAGTTGG - Intergenic
1182808976 22:33099674-33099696 GGGCTTGGACAGCTTGAAGTTGG + Intergenic
1184745732 22:46454652-46454674 CCACCCGGACAGCTTGGAGGTGG - Intronic
951530663 3:23695229-23695251 CTTCTCTGCCAGCTTGGAGTTGG + Intergenic
952611544 3:35216086-35216108 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
953536032 3:43777487-43777509 CAGCAAGGACAGCCTGGAGGTGG + Intergenic
953896897 3:46809950-46809972 CAGCTGACACAGCCTGGAGTGGG - Intronic
955839480 3:63096756-63096778 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
957966175 3:87324309-87324331 CAGCTCATACAGCTTGGTGTTGG - Intergenic
958916776 3:100058931-100058953 CAGTTTGGACAGCATGGAGAAGG + Intronic
962712816 3:138101865-138101887 CAGCTCGGACAGCTTGGCGTTGG + Intronic
964392119 3:156208546-156208568 CATCTCTGACAACTTGGAGGGGG + Intronic
964802249 3:160568869-160568891 CAGCTTGGAGAGCTTGGCATTGG - Intergenic
965605779 3:170496477-170496499 CAGCTCCGACCGCTTGGCGCTGG - Intronic
968626985 4:1630172-1630194 CAGCTCCGACAGCTTGGAAGGGG - Intronic
968835713 4:2963218-2963240 CACCTCGAACGGATTGGAGTTGG + Exonic
969918202 4:10510843-10510865 AAGGTGGGACAGCTTGAAGTGGG - Intronic
972197340 4:36670064-36670086 TAGCTCAGACAGCTGGGAGGTGG + Intergenic
976624710 4:87167426-87167448 CAGTGAGGACAGCCTGGAGTAGG - Intronic
976752330 4:88462164-88462186 CTGCATGGGCAGCTTGGAGTTGG + Exonic
977928671 4:102729106-102729128 CAGCTTGGACAGCTTGGCGTTGG + Intronic
982073849 4:151719380-151719402 CAGCTCTGAGAACTTGCAGTGGG + Intronic
985110357 4:186541454-186541476 CAGCTCGATCAGGTTGGAGACGG + Intronic
985720433 5:1485994-1486016 CTGCTCTGAGAGCTTGGAGCTGG + Intronic
990900488 5:60743939-60743961 CAGCTCAGACAGCTTGGCGTTGG + Intergenic
991306742 5:65184976-65184998 GAGCTCAGACAGCTGAGAGTTGG + Intronic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
995805328 5:116045971-116045993 CAGCTGAAACAGCTTGGAGAGGG + Intronic
997303728 5:132824145-132824167 CAGCTGGGACAGGTTTGAGGAGG + Exonic
997472541 5:134124851-134124873 CAGCTCAGACATGGTGGAGTGGG - Intronic
998887174 5:146706559-146706581 CAGCTCGGACAGCTTAGCGTTGG + Intronic
1005315506 6:24599398-24599420 CAGCTTGGACAGCTTGGCATTGG - Intronic
1012661850 6:101908094-101908116 CAGCTCGGACAGAATGATGTAGG - Intronic
1013609785 6:111783776-111783798 CAGCACGCCCAGCTGGGAGTGGG + Intronic
1014843880 6:126252211-126252233 GAGCTGGGACAGCTGGGACTTGG + Intergenic
1015496621 6:133889729-133889751 CAGCTTGGAGAGCTTGGTGTCGG - Exonic
1015539190 6:134297356-134297378 CAGCTCAGACAGCTTGGCGTTGG + Intronic
1016785297 6:148004859-148004881 TGGCTTAGACAGCTTGGAGTAGG - Intergenic
1018317263 6:162569322-162569344 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1018918813 6:168156499-168156521 CAGCTGGGACAGGATGGAGGAGG - Intergenic
1022477031 7:30717899-30717921 CAGCTAGGAAATCTTGGAATAGG + Intronic
1022944209 7:35265979-35266001 CATCTCTGGCATCTTGGAGTTGG + Intergenic
1023289658 7:38656239-38656261 CAGCTCAGACAGCTTGGCTTTGG - Intergenic
1024577354 7:50775421-50775443 CAGCTCTCACAGGTTGCAGTTGG + Intronic
1024681511 7:51694263-51694285 CAGCCCGGACTGCTTGGATGTGG - Intergenic
1024691148 7:51805008-51805030 CTGCTGGGACAGCTATGAGTAGG - Intergenic
1029453957 7:100657902-100657924 CAGCTCTGACAACTTGGGGTAGG + Intergenic
1030267530 7:107635571-107635593 CAGCTCAGACAACTTTGGGTGGG + Intergenic
1030866156 7:114704068-114704090 CAGCACAGACAGCTATGAGTGGG - Intergenic
1033648401 7:143322036-143322058 CAGCTTGGGGAGCTTGGAGCAGG + Intronic
1034487633 7:151375968-151375990 CAGCTTGGACAGCCTCGGGTGGG + Intronic
1041781144 8:61579265-61579287 CAGCTCGGACAACTTGGCGTTGG - Intronic
1042271541 8:66961502-66961524 CAGCTTGGACAGCTTGGTGTCGG + Exonic
1042722867 8:71843741-71843763 CAGCTTGGAGAGCTTAGTGTCGG + Exonic
1044459517 8:92428688-92428710 CAGCTTCCACAGCTTGGAATGGG + Intergenic
1048317652 8:133374285-133374307 CAGCTCTGACTGCTTTGAGCTGG + Intergenic
1048836655 8:138525096-138525118 AAGATCAGACAGCTTGGAGATGG - Intergenic
1050569181 9:6919918-6919940 CAGTTCTGATAGCATGGAGTAGG - Intronic
1056094249 9:83234737-83234759 AAGATTGGAAAGCTTGGAGTAGG - Intergenic
1057201796 9:93144459-93144481 CGGGTCGCACAGCTTGGAGAAGG - Intergenic
1057943653 9:99306205-99306227 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
1058372055 9:104280843-104280865 CATCTCAGCCAGCTGGGAGTAGG + Intergenic
1059403371 9:114084708-114084730 CAACTCGGTCAGCCAGGAGTTGG - Intergenic
1187173296 X:16871225-16871247 CAGCTCCGCCAGCTTGGGGTGGG - Intergenic
1189893782 X:45632671-45632693 CAGCTCGGACAACTTGGCCTTGG + Intergenic
1190537338 X:51442151-51442173 CAGCTCTCACAGGTTAGAGTAGG - Intergenic
1191220765 X:57985727-57985749 CAGCTGGGAAAGCTTGGCATTGG - Intergenic
1191810785 X:65186087-65186109 CACCTTGGGTAGCTTGGAGTTGG + Intergenic
1196734899 X:118974828-118974850 CAGCAGCGACAACTTGGAGTCGG + Exonic
1197568728 X:128121512-128121534 AAGGTGGGACAGCTTGAAGTGGG + Intergenic