ID: 1077736923

View in Genome Browser
Species Human (GRCh38)
Location 11:4801083-4801105
Sequence CAAAATGCTGATAGAAATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 725
Summary {0: 6, 1: 19, 2: 65, 3: 122, 4: 513}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077736923 Original CRISPR CAAAATGCTGATAGAAATAT GGG (reversed) Intronic
904777935 1:32923152-32923174 CATAATGCTGCTATAAATATTGG - Intergenic
904796368 1:33059285-33059307 CAAAACCTTGATAGGAATATGGG + Intronic
904983190 1:34523832-34523854 GAAGATGCTGAGAGAAATAGCGG + Intergenic
905020735 1:34809400-34809422 CAGAATGTTGGTAAAAATATTGG - Intronic
906760568 1:48373410-48373432 AAAAATTCTGATAGCGATATGGG - Intronic
908591592 1:65642676-65642698 AAAAATCCTAATAGAAAAATAGG - Intergenic
908919180 1:69169587-69169609 CAAAATGCTGATAATGATATAGG + Intergenic
909104434 1:71391347-71391369 CAAAATGCTGATAGTGATACAGG + Intergenic
909133962 1:71773534-71773556 AAAAAAGCTAATAGAATTATCGG + Intronic
909236019 1:73153345-73153367 GAAAATGCTGATAGTGATAATGG - Intergenic
909241986 1:73224742-73224764 CAAAATGCAGATACCAATAGCGG - Intergenic
909542475 1:76806429-76806451 CAGAATGTTGGTAGAGATATAGG + Intergenic
909752459 1:79179593-79179615 CAAAAGCCTGATAGTGATATGGG - Intergenic
909957563 1:81799571-81799593 CAAAATACTGATAGGTATTTAGG + Intronic
909998593 1:82313505-82313527 CAAAGTGCTGATAAACTTATGGG - Intergenic
910006664 1:82405426-82405448 CAGAAAGGTGATAGGAATATGGG - Intergenic
910874354 1:91864324-91864346 CAAATTGCTGACAAGAATATTGG + Intronic
912080553 1:105931362-105931384 CAAAATGCTAATAGCCAAATGGG + Intergenic
912121607 1:106478856-106478878 CAAAATGCTGATGATGATATGGG + Intergenic
912267508 1:108173766-108173788 CAAAATGCTGATAGTAATATGGG + Intronic
912548679 1:110469850-110469872 CATAATGCTGCTACAAACATGGG + Intergenic
912578587 1:110699414-110699436 CAAAAACCTGATGGAAAAATGGG + Intergenic
912620634 1:111153167-111153189 AAAAATGCTCATAGAAGTAAAGG - Intronic
912781624 1:112554671-112554693 AATAATGCTGCTACAAATATTGG - Intronic
913154593 1:116082915-116082937 AATAATGCTGCTATAAATATGGG + Intergenic
915779060 1:158525370-158525392 CAAAATCATGAAAGACATATTGG + Intergenic
917694406 1:177506839-177506861 GAAACTGTTGCTAGAAATATGGG - Intergenic
917698598 1:177556161-177556183 CAGAATGTTGGTAAAAATATGGG - Intergenic
917921330 1:179752995-179753017 GATAATGCTGCAAGAAATATGGG - Intronic
917990746 1:180375996-180376018 CAAAAACCTGATAGAAAAATGGG + Intronic
918191285 1:182176986-182177008 GATAATGCTGCAAGAAATATGGG + Intergenic
918598362 1:186320472-186320494 CACAATGGTGAAAAAAATATAGG + Intronic
918781446 1:188704850-188704872 CAAAAATCTGATAAAAATATAGG - Intergenic
919140549 1:193565882-193565904 TAAAAAGCTGATAGAAACACAGG - Intergenic
919409787 1:197228546-197228568 CAAAATGCTGATAGTAATATTGG - Intergenic
919675189 1:200375247-200375269 CCAACTGCTCTTAGAAATATTGG + Intergenic
919719275 1:200814251-200814273 CAAAATGCTTAAAGATACATGGG + Intronic
920026072 1:202998037-202998059 AATAATGCTGCTATAAATATGGG - Intergenic
920790863 1:209089900-209089922 CAAAATGCTTAAAGAAATAATGG + Intergenic
921771517 1:219046338-219046360 CAAAATGGAGATATAAATTTGGG - Intergenic
921996673 1:221426661-221426683 CAAAATGCTGATAATGATAATGG - Intergenic
922395152 1:225191614-225191636 AAAAATGTTGGTAGAAATACTGG - Intronic
922638705 1:227204636-227204658 TGAAATGCTGTTAGAGATATTGG - Intronic
923071994 1:230574121-230574143 CAAAATTCTGACATGAATATGGG + Intergenic
923090467 1:230736724-230736746 CAAAGTGCTGCTAGAAGAATTGG - Intergenic
923440107 1:234009782-234009804 CAATCTGCTGATAGTCATATTGG - Intronic
924265575 1:242278208-242278230 AAAAATGGTCATAGAAAAATAGG + Intronic
924280122 1:242428664-242428686 CAAAGTACTGAAAAAAATATAGG - Intronic
924525483 1:244844052-244844074 AGAAATGCTTAAAGAAATATTGG + Exonic
924661213 1:246019084-246019106 CAAAAAGCTCAGAGAAAAATGGG - Intronic
924785305 1:247191407-247191429 CAAAGTGCTGAAAGGAATAGTGG + Intergenic
1062766175 10:66990-67012 GCAATTGCTCATAGAAATATGGG + Intergenic
1063296221 10:4809549-4809571 CAAAAGGCTCATAGAACTGTTGG + Intronic
1063455694 10:6181322-6181344 AATAATGCTGATATAAACATGGG - Intronic
1063719822 10:8568744-8568766 CAAAATGATGATTCAAAGATTGG + Intergenic
1065166188 10:22980175-22980197 AAAAATGCTGATAATAATTTAGG - Intronic
1065341808 10:24714212-24714234 CAATATGCTGATTTAAGTATGGG - Intronic
1065401167 10:25303089-25303111 GTAAATGCTGATAGTAATTTAGG + Intronic
1066273398 10:33845185-33845207 CAAAATGCTGATAATGATATGGG - Intergenic
1066719250 10:38320258-38320280 AAAAATGGTCATAGAAAAATAGG - Intergenic
1066806212 10:39257559-39257581 CAAACTGCTGAAAGAAAGAAAGG + Intergenic
1067783216 10:49224039-49224061 CAAAATGCTGATAATGATATGGG - Intergenic
1068312848 10:55300572-55300594 GAAAATGTTGATGTAAATATTGG - Intronic
1068606186 10:59007751-59007773 CAAATTGCTGCTTGAATTATTGG + Intergenic
1068787969 10:60998040-60998062 CAGAATGATAATAGAAATTTAGG - Intronic
1069584959 10:69593384-69593406 CAAAATGCATATATATATATTGG - Intergenic
1070196039 10:74157319-74157341 AAAAAATCTGATGGAAATATGGG + Intronic
1070465493 10:76718854-76718876 CAAAATGCTGGCAGGAATAGGGG - Intergenic
1071105066 10:82084645-82084667 CAAAATGTTCACAGAAAAATAGG - Intronic
1071448124 10:85768457-85768479 CAATATTCTGATGAAAATATTGG + Intronic
1071925341 10:90400995-90401017 GAAAATATTAATAGAAATATTGG - Intergenic
1072296103 10:94010847-94010869 CAAAATACTGATAGAAATATGGG - Intronic
1072583940 10:96764992-96765014 CAGAATGCTAATAAAAATAGTGG - Intergenic
1072857729 10:98967159-98967181 CAAAAAGCTGATATAGATAATGG + Intronic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1073808079 10:107121876-107121898 GAAAATGGAGATAAAAATATTGG - Intronic
1074032363 10:109701614-109701636 AAAAATGCTTATAGATTTATGGG - Intergenic
1074409003 10:113208050-113208072 AAATATGCTGATAGTATTATGGG - Intergenic
1074730609 10:116370028-116370050 CAAAAGCCTGATAGAAAAATGGG - Intronic
1076457702 10:130612805-130612827 CCAAAAACTGAGAGAAATATAGG - Intergenic
1076786611 10:132752779-132752801 CAAAATGCTGAGAGAAAAGGAGG - Intronic
1077267393 11:1658244-1658266 CAAAATCTTTGTAGAAATATGGG - Intergenic
1077379148 11:2220400-2220422 TAAAATGCTGATAGACATGCAGG - Intergenic
1077736923 11:4801083-4801105 CAAAATGCTGATAGAAATATGGG - Intronic
1078137945 11:8667855-8667877 AATAATGCTGCTAGAAACATGGG + Intronic
1078332203 11:10433170-10433192 CAAAATCCTCATAAAAATACCGG + Intronic
1078393275 11:10955140-10955162 CAAAATGCTGATAGGGATATGGG + Intergenic
1078918925 11:15808716-15808738 TCAAATGGGGATAGAAATATAGG + Intergenic
1079137506 11:17784208-17784230 CAAAAAGCCGTTAGGAATATGGG + Intergenic
1079305795 11:19320579-19320601 TAAAATGATTATAGAATTATAGG - Intergenic
1079707443 11:23638295-23638317 CAAATTGCTGATAGTGATATGGG - Intergenic
1079758631 11:24299621-24299643 AATAATTCTGATAGATATATTGG + Intergenic
1079838742 11:25367547-25367569 CAAAATGGTGATAATTATATGGG - Intergenic
1079921418 11:26437839-26437861 AAAAATCCTAATAAAAATATTGG + Intronic
1080204986 11:29717886-29717908 CAAAATGCTGATAATAATATGGG - Intergenic
1080465963 11:32497368-32497390 AAAAATGCTGAGTGAAATAGTGG + Intergenic
1080997171 11:37618383-37618405 CAAAATACTGATAGTAACATGGG + Intergenic
1081122757 11:39286521-39286543 CAAAATACTGATAGCGATATGGG - Intergenic
1082307019 11:50591523-50591545 CAAACTGCTGAAAGAAAAAGTGG - Intergenic
1082674032 11:56073405-56073427 CACAATTCTGATAGAAATTGAGG + Intergenic
1082708086 11:56518321-56518343 CAAAGTGCTGGTAGAAATAGGGG - Intergenic
1082733212 11:56825391-56825413 CAAAATGCTGATAGTAATATGGG - Intergenic
1083138018 11:60698102-60698124 CCAAATGCATATAGAAATTTAGG + Intergenic
1084449336 11:69226026-69226048 AAAAATGCTTACAGAAATAATGG - Intergenic
1084626046 11:70308004-70308026 CAAAATGTATTTAGAAATATGGG + Intronic
1085649394 11:78253684-78253706 CAAAGTGATGAGAGAAAGATTGG - Intronic
1085918102 11:80915977-80915999 CAAAATGCTGAAAGAAGGAAAGG - Intergenic
1085978824 11:81695867-81695889 CAAAATGCTGAAAGAAAACCTGG + Intergenic
1086862023 11:91935429-91935451 AAAAATACTGATAGGAATAGGGG - Intergenic
1086992082 11:93314431-93314453 TAAAATGCTGATAGTGATATGGG - Intergenic
1087253224 11:95927008-95927030 ATAAATGGTGCTAGAAATATTGG + Intergenic
1087329823 11:96766813-96766835 TAAAATGCTGAAATAAACATGGG + Intergenic
1087741619 11:101894123-101894145 CAGAATACTGATAGAACTTTTGG - Intronic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1088141742 11:106625144-106625166 CAAACAGCTGACATAAATATTGG + Intergenic
1088454036 11:110014831-110014853 TTGAATGCTGATAAAAATATGGG - Intergenic
1088826460 11:113498672-113498694 CCAAAACCTGATAGAAATATTGG + Intergenic
1090506603 11:127321514-127321536 TAAAATGCTGATAGTGTTATGGG - Intergenic
1091129212 11:133130374-133130396 AAAAATGTTTTTAGAAATATTGG + Intronic
1092486003 12:8902533-8902555 CAAAATGCTGATAGCGATATAGG - Intergenic
1093411756 12:18876537-18876559 AAAAATGTGGATAAAAATATAGG - Intergenic
1093451252 12:19317502-19317524 AAAAATGCTCATAGGACTATAGG - Intronic
1094421250 12:30273439-30273461 CAAAATGCTGATAGTAATATGGG - Intergenic
1094537005 12:31330281-31330303 CAAAATTCTCAAAGAAAAATCGG + Intergenic
1095067589 12:37798791-37798813 CAAACTGCTGAAAGAAATAAAGG - Intergenic
1095254991 12:40024088-40024110 CAGAATCCTGATAGAGACATAGG - Intronic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1096332042 12:50722117-50722139 CAAAATTCTGGGTGAAATATTGG + Intronic
1096960340 12:55570708-55570730 CAAAATACTGATAGCAATATGGG - Intergenic
1097343751 12:58468239-58468261 AAAAATGGTGATAGTGATATGGG - Intergenic
1097485447 12:60192539-60192561 CAAAATTCTAATAGAAATAGTGG - Intergenic
1098003349 12:65968930-65968952 CAAGATTTTGTTAGAAATATTGG - Intergenic
1098807646 12:75039866-75039888 CAGAATTATGAGAGAAATATAGG + Intergenic
1098996578 12:77127757-77127779 AACAATGCTGTTATAAATATGGG - Intergenic
1099124305 12:78733154-78733176 CAAAAAGCTGTTTGTAATATTGG + Intergenic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099495611 12:83342710-83342732 CAAAATGCTGATAGTGGTATGGG + Intergenic
1099510167 12:83525128-83525150 CAAAATGCAAATAGAGAAATTGG + Intergenic
1099607848 12:84828251-84828273 CAAAATGCTAATACTGATATGGG + Intergenic
1099655168 12:85479921-85479943 CAAAATGCTGGTAGTGATATGGG - Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1100128735 12:91463150-91463172 GAAAATGCTGTCAAAAATATTGG - Intergenic
1100329220 12:93569899-93569921 AAAAATGCTTATCGAAATTTTGG + Intronic
1100371170 12:93970305-93970327 CAAAATTCTTAGAGAAATACTGG + Intergenic
1100593421 12:96051039-96051061 CAGAATGCTAGCAGAAATATAGG + Intergenic
1100728431 12:97435640-97435662 GAAAATGTTGAAAGAAATACTGG + Intergenic
1101190359 12:102326181-102326203 TAAAATGCTGATAGTGATATGGG + Intergenic
1101526465 12:105535651-105535673 CAAAATGCTGATAGGGATATGGG - Intergenic
1102070281 12:110013285-110013307 CTAAATGCTGATACAATTACTGG + Intronic
1103857058 12:123978849-123978871 CTAAATTCTGATATAAAAATGGG - Intronic
1104142609 12:126003367-126003389 CAAAATGCTGATAGTGATGTAGG + Intergenic
1104204656 12:126627005-126627027 AAAAATGCTGCTATGAATATGGG - Intergenic
1104659351 12:130599065-130599087 AAAAATGGTGATGGAAATATTGG + Intronic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1105734519 13:23254236-23254258 CAAAATGCTGTTAGAAATGTGGG + Intronic
1105928394 13:25029560-25029582 CAAAGTGTGGAGAGAAATATGGG - Intergenic
1106358665 13:29009837-29009859 TAAAAAGCTGATTGAAATCTAGG + Intronic
1107811383 13:44203202-44203224 CAGAATGCTTATATAAATAATGG - Intergenic
1108969274 13:56351455-56351477 ATAAGTGCTGATAGAAATCTGGG - Intergenic
1109119621 13:58438295-58438317 CCAAATTCTGTTAGAAATTTAGG - Intergenic
1109359703 13:61280214-61280236 CAAAATGCTAATAGTGATATTGG + Intergenic
1109421616 13:62119738-62119760 CGAAATGCTGAAAAGAATATCGG + Intergenic
1110000915 13:70198761-70198783 CAGCATGCTGATCAAAATATAGG - Intergenic
1110007662 13:70293249-70293271 CAAAATGTTGATGGTGATATGGG + Intergenic
1110951699 13:81501056-81501078 AAGAATGCTAATAGAAATACTGG - Intergenic
1111221242 13:85207840-85207862 CAAAGTGCTGATAGTGATATGGG + Intergenic
1111255611 13:85663496-85663518 CTAAATCCTCATTGAAATATGGG - Intergenic
1111707694 13:91771134-91771156 CAAAAATCTGATAGAAAATTAGG + Intronic
1112859015 13:103807793-103807815 CAAAATGCTGGTAGTTACATGGG + Intergenic
1112861455 13:103833063-103833085 CAAAATACTGATACTGATATTGG + Intergenic
1112958121 13:105086617-105086639 CAAAGTGCTAATTGAAATTTAGG + Intergenic
1112983170 13:105412506-105412528 GAATATGCTGCTAGGAATATTGG + Intergenic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1114507520 14:23229328-23229350 AATAATGCTGGTAGGAATATTGG + Intronic
1114917271 14:27284740-27284762 CAAAATGCTGATAAAGATTTTGG + Intergenic
1114961278 14:27893089-27893111 CAAAATGTTGATAATCATATGGG + Intergenic
1115449922 14:33535857-33535879 ATCAATGCTGATAGAAAAATAGG - Intronic
1116147848 14:41098975-41098997 CAAAATGCTGATAGCAATATGGG + Intergenic
1116544475 14:46147046-46147068 CAAAGTGCTGATAGCAAAAATGG - Intergenic
1116587794 14:46731873-46731895 CAATATGGCCATAGAAATATAGG - Intergenic
1116784036 14:49268240-49268262 CAAAATGCTGATAGTGATTTGGG + Intergenic
1117003027 14:51390934-51390956 AAAAATGCTGCTATGAATATGGG - Intergenic
1117262639 14:54052007-54052029 CAAAGTGCTGATAGAAAAATGGG - Intergenic
1117264067 14:54067394-54067416 CCACATGCTGAGTGAAATATTGG + Intergenic
1117880528 14:60309008-60309030 CATATTGCTGATACAAATAGGGG - Intergenic
1117988491 14:61411443-61411465 CCAAATGCTGAAACAAGTATTGG + Intronic
1119114084 14:72002251-72002273 CCAAATGCTGATAAAGAAATTGG + Intronic
1120072723 14:80122036-80122058 CAAAATGCTGATAGAAATATGGG + Intergenic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1120678884 14:87455280-87455302 TTCAATGTTGATAGAAATATTGG - Intergenic
1121394608 14:93609135-93609157 CCAATTGCTGAGAGGAATATTGG + Intronic
1122486241 14:102083051-102083073 CAAAATCATGAAAGACATATTGG - Exonic
1122754133 14:103964373-103964395 CAAAATGTTAATAGAAACTTGGG + Intronic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1123827176 15:24093734-24093756 CACAATGCTGATAGTGACATGGG - Intergenic
1123841782 15:24254613-24254635 CACAATGCTGATAGTGACATGGG - Intergenic
1123861159 15:24468067-24468089 CACAATGCTGATAGTGACATGGG - Intergenic
1124087712 15:26567027-26567049 CAAAATGCTAAAAATAATATTGG + Intronic
1125703579 15:41710651-41710673 TAAAATGCTTAAAGAAATCTAGG - Intronic
1126384640 15:48081585-48081607 CAAAACTCTAATAGAAAAATTGG - Intergenic
1126512954 15:49501292-49501314 CAAAATGCTGATACTGATATGGG + Intronic
1126656143 15:50980110-50980132 CAGAAAGTTGTTAGAAATATGGG + Intronic
1126787395 15:52188599-52188621 CAAAATGCTCATCGAAACATTGG - Intronic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1126985313 15:54299986-54300008 AAAAGCGCTGATATAAATATGGG - Intronic
1128102751 15:65017233-65017255 CAAAATGTTGATAGGAACATGGG + Intronic
1129165916 15:73777399-73777421 CAAAATGGAGATAGCAATAGGGG - Intergenic
1129429844 15:75491702-75491724 CAGAAAACTGGTAGAAATATGGG + Intronic
1129937443 15:79462639-79462661 CAAAATGGTGAAAGAAAGAGGGG + Intronic
1130186589 15:81689318-81689340 CAAAATGCTTCAAGAGATATGGG - Intergenic
1130634794 15:85607481-85607503 CAAAATGGGGATAAAAATAAAGG - Intronic
1130733115 15:86519915-86519937 GAAATTGCTGATTGAAATTTGGG - Intronic
1130762233 15:86832664-86832686 CAAAATGCTGACAGTGATATGGG - Intronic
1131410101 15:92200401-92200423 CAAAATGCTGATAGAAATATGGG + Intergenic
1131453657 15:92566408-92566430 CAAAATGCTCATAGAAATATGGG - Intergenic
1133823433 16:9257058-9257080 CAAAATGCTAAATTAAATATAGG - Intergenic
1134177412 16:12019010-12019032 TAAAATGCTTATAGAAAACTTGG - Intronic
1134352913 16:13454606-13454628 CAAAATGGCGATTCAAATATAGG + Intergenic
1134477788 16:14590842-14590864 CAAAATGCTGACGGAACAATGGG + Intronic
1135894927 16:26390976-26390998 AAGAATTCTGATAGAAATGTTGG - Intergenic
1136662808 16:31780059-31780081 CAAAATGCTGGTAGTGATATGGG + Intronic
1136739115 16:32497500-32497522 CAAACTGCTGAATGAAATAAAGG - Intergenic
1137229214 16:46546902-46546924 TCAAATGTTTATAGAAATATAGG - Intergenic
1137264171 16:46855126-46855148 CAAAGTGCTGAAAGAAATGCAGG + Intergenic
1137814527 16:51385949-51385971 CTAAATTCTGCTAAAAATATAGG + Intergenic
1137880411 16:52040025-52040047 AATAATGCTGTTATAAATATTGG + Intronic
1138240366 16:55422766-55422788 AATAATGCTGATAGAGTTATTGG - Intronic
1139041240 16:63001518-63001540 CAAAATGCTGATAGTAATGTGGG + Intergenic
1139083983 16:63561904-63561926 CAAAATGCTGATAATGATATGGG - Intergenic
1139320531 16:66110393-66110415 CAGAATGTTGGTAGAAATACAGG + Intergenic
1139619887 16:68130094-68130116 AATAATGCTGAAAGAAACATAGG + Intronic
1140676756 16:77339730-77339752 GAAAATGTTAATAGAAATGTTGG - Intronic
1140690249 16:77476768-77476790 TAAAATGCTAATAGAAATGGTGG - Intergenic
1141613217 16:85195578-85195600 CCAAATGGTGTCAGAAATATAGG - Intergenic
1203014097 16_KI270728v1_random:334292-334314 CAAACTGCTGAATGAAATAAAGG + Intergenic
1203032432 16_KI270728v1_random:607451-607473 CAAACTGCTGAATGAAATAAAGG + Intergenic
1143470428 17:7171117-7171139 CAAAATGATGAAAGACACATTGG - Intergenic
1143666382 17:8364171-8364193 AAAAATAATGATAAAAATATTGG - Intergenic
1143701186 17:8661378-8661400 GAAGATGATGATAGAAATATAGG - Intergenic
1143973443 17:10812732-10812754 GAAAATGGTGACAGAAATATCGG - Intergenic
1144630261 17:16868083-16868105 AAGAATGCTGCTAGAAACATGGG - Intergenic
1146530045 17:33600810-33600832 CAGAATGTTGGTAGAAATATGGG + Intronic
1148247210 17:46041009-46041031 CAAAATACTGATAGAAATACGGG + Intronic
1149025004 17:52017343-52017365 CAAAATGCTGATAGAAACATTGG + Intronic
1149129095 17:53274175-53274197 CCAAATGCTCATAGAAAAATCGG + Intergenic
1149154958 17:53617497-53617519 CAAAATACTAACATAAATATAGG - Intergenic
1151841595 17:76622205-76622227 CAAAAACCTAATAGAAAAATAGG - Intergenic
1152048501 17:77954821-77954843 CACTATGCTGATAATAATATTGG - Intergenic
1152916919 17:83043786-83043808 CAAAATGCTGAAATAAAAAGTGG + Intronic
1152959044 18:66569-66591 GCAATTGCTCATAGAAATATGGG + Intronic
1153867140 18:9281038-9281060 GTAAATGCTGATAGATTTATAGG - Exonic
1154958430 18:21282967-21282989 AAAAATGCTCATAGAAAAATAGG - Intronic
1155592804 18:27447271-27447293 CATAATTCTGCTAGAAATAATGG - Intergenic
1156178196 18:34572468-34572490 CAAAAAGATGATAATAATATTGG - Intronic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1156307900 18:35896292-35896314 TAATATGCTGCTAGCAATATGGG + Intergenic
1156780083 18:40840256-40840278 GAAAATGCAGATAGTAAAATGGG - Intergenic
1156929498 18:42624777-42624799 CTAAATGCTGGGAGAAAAATAGG - Intergenic
1156975866 18:43220957-43220979 CAGAAAGCTGATAGAAATACAGG - Intergenic
1158096345 18:53776238-53776260 CAAAATCATCATAGAAAAATCGG - Intergenic
1158441810 18:57481615-57481637 GAAAATGTTGGTAGAATTATAGG + Exonic
1158782881 18:60673036-60673058 CAAAATTCTGATTGATATTTAGG + Intergenic
1158882581 18:61795189-61795211 GAAAATGGTGAAGGAAATATGGG - Intergenic
1159280263 18:66275797-66275819 TAAAATATTGATATAAATATTGG - Intergenic
1159767531 18:72508539-72508561 TAAAATACTGATAGAAATGAAGG + Intergenic
1159786993 18:72726662-72726684 TAAAAAGCTGAGAGAAATACAGG + Intergenic
1159970087 18:74639289-74639311 CAAAATTGTAATACAAATATTGG + Intronic
1160010266 18:75101965-75101987 TGAAATGTTGATAGAAATATGGG - Intergenic
1160459597 18:79028085-79028107 AAAAATACTGAAAGAAATAATGG + Intergenic
1166017420 19:39993266-39993288 TAAAATGCTGATAGTGATAACGG + Intronic
1167735412 19:51291619-51291641 CAAAATGATGACAGAAATCTGGG + Intergenic
1168514398 19:56999068-56999090 CAAAATACTTATGTAAATATTGG - Intergenic
1168702307 19:58448257-58448279 CAAAATGCTGATAATGATATGGG + Intergenic
924984719 2:260084-260106 CAAAATGCAGACAGTAGTATTGG - Intronic
925638535 2:5965658-5965680 CAAAATGCCGATAGTGATATGGG - Intergenic
925860266 2:8168561-8168583 CAAAAAGCTGATGGAAAGCTAGG + Intergenic
926984050 2:18601853-18601875 AAAAGTGCTGAAAGAAACATGGG - Intergenic
928148477 2:28804941-28804963 CAAAGTGCTGGGAGAATTATAGG + Intronic
928941113 2:36728243-36728265 TAAAATAATGATAAAAATATAGG - Intronic
929081501 2:38126948-38126970 CAAAATGCTCATAGTGATATGGG + Intergenic
929612688 2:43283485-43283507 CAAAATGCTGACAGTGATATGGG + Intronic
930471081 2:51814463-51814485 CAACATACTCAAAGAAATATAGG + Intergenic
930577933 2:53174821-53174843 CAAAATGCTAATGCAAATCTAGG - Intergenic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
930952243 2:57156868-57156890 AAAAATGCTGATAGAGATATGGG - Intergenic
931107065 2:59067787-59067809 CATACTGCTGCTAGAAATCTGGG + Intergenic
931333176 2:61309781-61309803 TAAAATGTTGATAAAAATACTGG - Intronic
931724869 2:65100099-65100121 GAAAATGTTTTTAGAAATATGGG + Intronic
931726463 2:65116202-65116224 TGAAATGCTGAAAGAAATTTGGG + Intronic
932382195 2:71294823-71294845 CAAATTGCTGAAAGAAATAAAGG - Intronic
932541587 2:72660699-72660721 TAAAATGATGACAGAAGTATTGG + Intronic
932897983 2:75662461-75662483 CAAAAAGCTGAAAGAAATTCAGG + Intronic
933046104 2:77539308-77539330 CAAAATGCTGATTGTGATATGGG + Intronic
935330051 2:101970342-101970364 CAAAATGCAGATAGAAATATGGG - Intergenic
935925354 2:108062900-108062922 CAAAATCCTGAACAAAATATTGG + Intergenic
935950071 2:108320643-108320665 CTAAATGCTGAGAGAAATCCTGG + Intergenic
936718023 2:115213115-115213137 GAAAATTCTGAGAGAATTATAGG + Intronic
936850889 2:116896334-116896356 AAAAATGCTGATAGTGATATAGG - Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
937015416 2:118601052-118601074 CACACTGCTGATAGCAATACTGG + Intergenic
937569897 2:123343952-123343974 AATAATGCTGATATGAATATGGG + Intergenic
937611084 2:123862370-123862392 CAAAGTGCAAATAGAAAAATTGG + Intergenic
938186492 2:129236775-129236797 CAAAATGTTGATAGGAATCTGGG + Intergenic
938681308 2:133693688-133693710 AGAAATGCTCAAAGAAATATTGG - Intergenic
938768259 2:134478391-134478413 CATAATGCTCATAAAAATATGGG + Intronic
938877708 2:135550541-135550563 GAAAATGCTTACAGAAATACTGG + Intronic
939482770 2:142770371-142770393 CAAAATGCTGATAGTGACATGGG + Intergenic
939677511 2:145090686-145090708 CAGAATGTTGATGGAAATATGGG + Intergenic
940026760 2:149216507-149216529 CAAGATGCTGAGTGAAAGATAGG - Intergenic
940049532 2:149447713-149447735 CAACATGCAAATAAAAATATTGG - Intronic
940270756 2:151887504-151887526 CAAAATGCAGATAGTAACACTGG + Intronic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940621644 2:156120989-156121011 CAAAATGCTAATAGTGATATGGG + Intergenic
940838530 2:158552529-158552551 CAAAACGTTGGTAGAAATGTGGG + Intronic
941311412 2:163936981-163937003 TTAAATGCTGAAAGAAATCTTGG - Intergenic
941578647 2:167267894-167267916 CAAAATGCTGATAATGATATGGG + Intergenic
941850187 2:170172649-170172671 CCAAGTGCTGAGAAAAATATAGG - Intergenic
942629917 2:177944512-177944534 TAAAAAGCTGATGGAAATTTAGG + Intronic
943005088 2:182379487-182379509 CAAACGTCTGATAGAAATAAGGG + Intronic
943213065 2:184993300-184993322 CAACATTCTGATAGATATATTGG + Intergenic
943227620 2:185200116-185200138 CAAAATTATGATAGATATATAGG - Intergenic
943334647 2:186599221-186599243 CAAGAAACTGATTGAAATATAGG - Intronic
943902791 2:193462772-193462794 GTAACTGCTGGTAGAAATATGGG + Intergenic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
945519438 2:210805587-210805609 CAAATTCCTGAAAGAAATAAGGG + Intergenic
945617559 2:212091609-212091631 CAAAGGGCTTAAAGAAATATTGG + Intronic
946349668 2:219141678-219141700 AAACATGCAGAAAGAAATATGGG + Intronic
946468973 2:219938951-219938973 CAGAATGCTCATAGAAACATGGG + Intergenic
946697068 2:222370352-222370374 AAAAATGCTGATCTATATATTGG + Intergenic
947007559 2:225529629-225529651 GAACATGCTTATATAAATATAGG - Intronic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
947889731 2:233606326-233606348 CAAAACGCTGATAAAAATATGGG - Intergenic
948090459 2:235289601-235289623 CAAAAGCCTGATAGATAAATGGG + Intergenic
949049439 2:241889142-241889164 TAAATTGTTCATAGAAATATAGG + Intergenic
1169585125 20:7073445-7073467 AATAATGCTGCTATAAATATTGG + Intergenic
1170725164 20:18919682-18919704 CACAATGCTGATAGTGATATGGG + Intergenic
1170927137 20:20735244-20735266 CAAATTTCTAATAGAAAAATGGG + Intergenic
1171197245 20:23209412-23209434 CAGAATGTTGATATAAATATGGG + Intergenic
1171268317 20:23792573-23792595 CAAAAAGCTGATAGAACCCTTGG - Intergenic
1173323519 20:42010746-42010768 CAAAATGCTGACAGTGATAATGG - Intergenic
1173677188 20:44846146-44846168 CAATATGCTGAAAGAACTAAAGG - Intergenic
1173718015 20:45227921-45227943 AAAAGTGGTGAAAGAAATATCGG - Intergenic
1174040035 20:47692987-47693009 CAAAATGCTGATTGAAGACTGGG + Intronic
1174755696 20:53156199-53156221 CCCATTGCTGATAGAGATATGGG - Intronic
1175347971 20:58296038-58296060 GCAAATGCTGATAGAAACAAGGG + Intergenic
1176657789 21:9603282-9603304 CAAAATGCTGATAATGATATGGG - Intergenic
1177268770 21:18818987-18819009 AAAACTGATGATAGAAAAATTGG + Intergenic
1177340492 21:19793421-19793443 CAAAATAATGATAAATATATTGG - Intergenic
1177394180 21:20511550-20511572 TAAAATGCTGATAGTGATATGGG - Intergenic
1177475914 21:21622436-21622458 GAAAATGCTGCTATGAATATTGG + Intergenic
1177478071 21:21650425-21650447 CAATATGCTAATAGAAATATGGG + Intergenic
1177604557 21:23360804-23360826 CAAAACGCTGATAGTGATACGGG - Intergenic
1177614664 21:23501168-23501190 CAAAATGCTGGTAGTGATATGGG + Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1177762171 21:25414473-25414495 CTAAAATGTGATAGAAATATTGG - Intergenic
1177858234 21:26423340-26423362 CCAAAGGCTGAGAGAAATGTAGG + Intergenic
1177946790 21:27480396-27480418 CTAAATTTTGATAGAAATATGGG - Intergenic
1178143882 21:29716492-29716514 CAAAATGCTGATAGTAATGTGGG + Intronic
1179094609 21:38301376-38301398 GAAATGGCTGAAAGAAATATTGG - Exonic
1179156464 21:38855975-38855997 CAAAATGCTGATAATAATAGGGG + Intergenic
1179190185 21:39116741-39116763 TAATATGCTGGTAGACATATGGG + Intergenic
1180685776 22:17665327-17665349 CAAAATGCTGACAGTGATATGGG - Intronic
1181843176 22:25682862-25682884 AAATATGCTGTTAGAAATCTGGG - Intronic
1182458284 22:30466709-30466731 CAAAATGGGGATAGCAATGTAGG - Intronic
949185780 3:1189918-1189940 CAAAATGATGATATGAATTTAGG + Intronic
950639316 3:14338303-14338325 CATAATGTTGCTATAAATATCGG - Intergenic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
951683766 3:25322324-25322346 CAAAGTTCTAAAAGAAATATGGG + Intronic
951843659 3:27062368-27062390 CACAATGAAGGTAGAAATATAGG - Intergenic
952112577 3:30141120-30141142 CAAAATGATAAGAAAAATATGGG + Intergenic
952246660 3:31601299-31601321 CATAAAGCTGATAGACATTTGGG - Intronic
953100150 3:39816738-39816760 CATAATAATTATAGAAATATAGG + Intronic
953382596 3:42485055-42485077 TAAAATACTGGTATAAATATAGG + Intergenic
953394914 3:42560983-42561005 AAATATGCTGAGAAAAATATGGG - Intronic
953997105 3:47528318-47528340 CAAAATACTCAGAGAAATAATGG + Intergenic
955381896 3:58445589-58445611 AATAATGCTGCTATAAATATTGG + Intergenic
955675566 3:61444679-61444701 CAAAAAGCTGATGAAGATATGGG - Intergenic
955882928 3:63566861-63566883 CATAAAGCTGATAAAAATAATGG - Intronic
956321629 3:68004003-68004025 CAAAATACTGATAGTATTAGTGG - Intergenic
957097653 3:75791863-75791885 AATAATGCTGAAATAAATATGGG - Intergenic
957282231 3:78168625-78168647 GAAAATGCAGTTACAAATATAGG + Intergenic
957515796 3:81249389-81249411 CCAGATGCTGATAGAAAAACAGG - Intergenic
957602313 3:82353593-82353615 CAAAATGCTATTAAAAACATGGG + Intergenic
957881860 3:86225806-86225828 AAAAATGCTGCTATAAACATGGG - Intergenic
957899261 3:86467310-86467332 GAAAATGCAAATGGAAATATGGG + Intergenic
957903964 3:86534174-86534196 CAAAATACTGGTAGAAATATGGG - Intergenic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
959195572 3:103176225-103176247 AATAATGCTGATATAAACATGGG + Intergenic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
959260350 3:104071607-104071629 CAAAATGCTGATAAAAATCCAGG + Intergenic
959604449 3:108226908-108226930 CAAAATGCTATTAAAACTATGGG + Intergenic
959679519 3:109077138-109077160 TTAAATGGTTATAGAAATATTGG - Intronic
960435433 3:117620982-117621004 CAAGATTCTCAAAGAAATATGGG + Intergenic
960774852 3:121237942-121237964 CAAAATACTGACAGAAATATGGG - Intronic
962400475 3:135055014-135055036 CAAAATATTAATAGAATTATGGG - Intronic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963433805 3:145242550-145242572 CAACATGCTGATAGTGATAAGGG - Intergenic
963539566 3:146567790-146567812 CAAAATGATGATAGTGATATGGG - Intergenic
964520830 3:157564453-157564475 CAAAATGCTGATAGTGATACGGG - Intronic
964696895 3:159518690-159518712 CTAAAAGCAGATAGAAATGTAGG + Intronic
964838382 3:160966600-160966622 AATAATGCTGCAAGAAATATGGG + Intronic
964858742 3:161176413-161176435 CAAAATGCTACTATAAAAATAGG + Intronic
965232713 3:166073438-166073460 AAAAATGCTGATAGAAATATGGG - Intergenic
965326460 3:167310228-167310250 CAAAATGCTTATAGTGATAATGG - Intronic
965349305 3:167594280-167594302 CAAAATGTTCATAGTGATATGGG + Intronic
965717636 3:171624195-171624217 CAAAATCTTAATAGAAAAATGGG + Intronic
965788435 3:172361571-172361593 CAAAGCGCTGATGGAAATATGGG - Intronic
966075783 3:175935602-175935624 CAAAATGCAGGTAGTGATATGGG + Intergenic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
966774311 3:183530687-183530709 TAAAATGCTTATGGAATTATAGG + Intronic
967678607 3:192331857-192331879 CCAAATGCTGAGAAAAATATTGG + Intronic
968325611 3:197812449-197812471 AATAATGCTGATGTAAATATTGG + Intronic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
969545164 4:7821333-7821355 CAAAATGCTGACAGTAATGACGG - Intronic
970317425 4:14842713-14842735 CAGAATGTTGGTAGAAATAGGGG - Intergenic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
970742940 4:19259263-19259285 GAAAAAGCTTATAGAAATAAAGG + Intergenic
970885841 4:20986660-20986682 AAATCTGCTGATAGAAATAAAGG - Intronic
970915095 4:21322903-21322925 CAAATTGCTGTTAGATATAATGG - Intronic
971521098 4:27551338-27551360 CAAAATACAGACACAAATATAGG - Intergenic
971546205 4:27890522-27890544 CAAAATGTTGATAGTGATATGGG + Intergenic
971546637 4:27894725-27894747 CAGAATGTTGGTAGATATATGGG - Intergenic
971601823 4:28601789-28601811 AAAAATGTTGGTAGATATATAGG + Intergenic
971722330 4:30261677-30261699 TAAAATGCTGATAGAAATTCTGG - Intergenic
971852333 4:31998085-31998107 CATAAATCTGAAAGAAATATTGG + Intergenic
971860481 4:32096819-32096841 CAGAATGTTGATAGAAATATGGG - Intergenic
971972478 4:33637752-33637774 CAAAATGCTGATAGAGAATAAGG - Intergenic
972896022 4:43620928-43620950 CAAAATGCTGATAGTAATATGGG - Intergenic
973114740 4:46441439-46441461 CAATATGATTATATAAATATAGG + Intronic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
974376383 4:61082139-61082161 CAAAAAATTGATGGAAATATAGG - Intergenic
974477250 4:62399056-62399078 AAAAAACCTGATAGAAATATGGG - Intergenic
974637921 4:64589675-64589697 CAGAATGCTGATAGTGATATGGG + Intergenic
975320424 4:73004246-73004268 TAAAATGCTGGTAAAAATAAAGG - Intergenic
975489358 4:74971520-74971542 CAAAATGCTGTTAATAAAATAGG - Intronic
975506613 4:75145129-75145151 TAAAATGCTGACAGAAATATGGG - Intergenic
975900951 4:79152009-79152031 AACAATGCCCATAGAAATATTGG - Intergenic
976001844 4:80383512-80383534 TAAAATGCTGATGGAAATTATGG - Intronic
976034844 4:80804566-80804588 AATAATGCTGCTATAAATATGGG + Intronic
976585510 4:86792330-86792352 ACAAATGCTCTTAGAAATATGGG + Intronic
976787870 4:88842931-88842953 CAAAATACTGAGAGAAATATCGG + Intronic
977115073 4:93014104-93014126 TGAAAGGCTTATAGAAATATGGG + Intronic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
977379534 4:96254330-96254352 TAAAATACTGAAAGAAAAATTGG + Intergenic
978684599 4:111424252-111424274 CAAAATGCAGTTAGAAATTGAGG - Intergenic
979060987 4:116059935-116059957 CAAAGTGCTGATAGTGATGTGGG - Intergenic
979125708 4:116969397-116969419 CAAAATGCTAATAGTGCTATTGG - Intergenic
979423857 4:120540163-120540185 CAAAATGCTTATAGTCATGTTGG - Intergenic
980431253 4:132699495-132699517 CAAAAGACAGATAGATATATTGG + Intergenic
980534350 4:134096456-134096478 CAAAATATTCATAAAAATATTGG + Intergenic
980743908 4:136990375-136990397 AATAATGCTGAAATAAATATTGG - Intergenic
981249838 4:142586507-142586529 CAAAATGCTGTTGGGAATAATGG - Intronic
981343249 4:143647051-143647073 TAAAATGTTGATAGTGATATGGG + Intronic
981355372 4:143783941-143783963 CAAAATGCTGGTAGAAATATGGG + Intergenic
981391464 4:144196361-144196383 CAAAATGCTGATAGTGATACAGG + Intergenic
981412066 4:144443373-144443395 CAAAATGCTGTTAGTAATACGGG - Intergenic
981503193 4:145474189-145474211 CAAAATGCTAATAGTGATATGGG - Intergenic
981842887 4:149132918-149132940 TAAAATGCTGATAGTGATATGGG + Intergenic
982210281 4:153029194-153029216 CAAAATGCTGATAGAAATATGGG - Intergenic
983320427 4:166190070-166190092 GAAAATGCTGATAATGATATGGG + Intergenic
983379032 4:166967892-166967914 CAAAATGCTGATAGTGATGTGGG + Intronic
983660360 4:170125563-170125585 TAAAATGCTGATAATGATATTGG + Intergenic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
983769824 4:171535531-171535553 TAGAATGTTGGTAGAAATATGGG + Intergenic
984131358 4:175879139-175879161 CAAAATGCTAATAATGATATGGG - Intronic
984512358 4:180694017-180694039 CAAAATACTAATAGTGATATAGG - Intergenic
985417621 4:189752804-189752826 CAAAATGCTGATAATGATATGGG + Intergenic
986537426 5:8805375-8805397 CAAAATGCTGATAGTAATATGGG + Intergenic
987459955 5:18197400-18197422 CAAAATGCTGAAAGAAATATGGG + Intergenic
987478319 5:18420391-18420413 CAAACTGCTGCCACAAATATTGG + Intergenic
987790002 5:22552733-22552755 TAAAATGTTAATAGAAAAATGGG - Intronic
987918647 5:24249435-24249457 CAAAATGCTGACAGTGACATGGG - Intergenic
988009510 5:25464379-25464401 CATAATGCTGATAGTAATATGGG + Intergenic
988038849 5:25861985-25862007 CAAAATGCTGATAGTAATATGGG - Intergenic
988076760 5:26363821-26363843 CAATATGCTGATAGTGATAAGGG + Intergenic
988213896 5:28246435-28246457 AATAATGCTGTTATAAATATTGG - Intergenic
988238882 5:28582013-28582035 CAAAATGCTTAGAAAAATCTAGG + Intergenic
988456307 5:31390007-31390029 CAAAATGCTAATAGTGATATGGG - Intergenic
988876866 5:35456644-35456666 CAAAATGCTGATGGTGATAGGGG + Intergenic
989408162 5:41085633-41085655 GACAATGCTGAAAGAAATATTGG - Intergenic
989539790 5:42605521-42605543 CAAGAAGCAGCTAGAAATATTGG + Intronic
989677025 5:43984164-43984186 CAAAATGCTGACAGTGACATGGG - Intergenic
989817323 5:45751751-45751773 CAAAATGCTGATAGTGATAATGG - Intergenic
989845992 5:46141994-46142016 CAAACTGCTGAAAAAAATAAAGG - Intergenic
990075844 5:51844583-51844605 CAAAATGCCAATAGGGATATAGG - Intergenic
990221752 5:53599212-53599234 AAAAATGCTGCTATAAACATTGG + Intronic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
991053278 5:62295341-62295363 AAAAATGCTCAATGAAATATTGG + Intergenic
991144996 5:63290940-63290962 CAAAAATCTGATAGAAAAATGGG - Intergenic
991186487 5:63814842-63814864 CAAAATGCTGATAGTGACATGGG + Intergenic
992161272 5:74005642-74005664 AAAAATGTTCATAGAAATAATGG - Intergenic
992181592 5:74203094-74203116 CAAAACGCTATTAAAAATATTGG - Intergenic
992335618 5:75765808-75765830 CATGATGCTGATATAAAAATTGG - Intergenic
993001036 5:82380593-82380615 CAAAATGCTGATAATGATATGGG - Intronic
993526826 5:88975521-88975543 TAGAATGATTATAGAAATATTGG + Intergenic
993642291 5:90419894-90419916 AATAATGCTGCTACAAATATGGG - Intergenic
993792625 5:92225203-92225225 CAAAATACTGATAGTGAGATGGG - Intergenic
994056557 5:95423114-95423136 CAAAATGCTCATTGGAATAGAGG - Intronic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994571369 5:101518149-101518171 TAAATTGATGATAGAAAAATAGG + Intergenic
994626454 5:102226193-102226215 GAAAAGGATGAAAGAAATATAGG + Intergenic
994849569 5:105036671-105036693 CAAAACCCTGATAGTGATATGGG - Intergenic
995211964 5:109550959-109550981 CAAAATGCTGATAGCCATATGGG + Intergenic
995916478 5:117251596-117251618 CATAATACAAATAGAAATATAGG + Intergenic
995967700 5:117929166-117929188 CTAAATGCTAATAGAATTCTGGG + Intergenic
996041984 5:118824641-118824663 TAAAATTCTGATAGAAATTCTGG - Intergenic
997056989 5:130455609-130455631 TAAAATGCTGACAAAAATCTTGG - Intergenic
997305997 5:132836945-132836967 CAAAATGCTACTAGGATTATAGG - Intergenic
1000609540 5:163359281-163359303 CAAAATGCTGATAGTGATAATGG + Intergenic
1000688316 5:164281553-164281575 CAAAATGGTGCTAGAATAATTGG + Intergenic
1000768416 5:165319765-165319787 CAAAAAGCTGATAGTGATATGGG - Intergenic
1000772311 5:165370589-165370611 AAAAATGATGGTAGAATTATTGG - Intergenic
1000783092 5:165509348-165509370 CAAAAGGCAGAAAAAAATATAGG + Intergenic
1000896118 5:166857725-166857747 CACATTGCTGATTGAAATCTTGG + Intergenic
1000988268 5:167884697-167884719 AATAATGCTGCTAGGAATATTGG + Intronic
1002146959 5:177191411-177191433 TAATACGCTAATAGAAATATTGG + Intronic
1002893508 6:1359193-1359215 CAAAAACCTAATAGAAAAATAGG - Intergenic
1003216169 6:4114746-4114768 CAAAATGAAGATAAAAATCTAGG - Intronic
1003509783 6:6769893-6769915 CAAAATGCAGCTAGAATTGTGGG + Intergenic
1003798236 6:9630197-9630219 CCAAATGCTGATAGTGACATGGG + Intronic
1004324043 6:14657468-14657490 CACAATGCTGATAGGGCTATTGG - Intergenic
1005318389 6:24627216-24627238 CAGAATGCTGTAAGAATTATGGG + Intronic
1005770715 6:29067948-29067970 CAAAATTCTTAAAGAAAAATTGG + Intronic
1006344060 6:33465786-33465808 CAAAATGCTGATAGCAATATGGG + Intergenic
1006948846 6:37804824-37804846 CAAAATTCTAAGAGGAATATTGG + Intergenic
1007220306 6:40273692-40273714 CAGCATGTTGGTAGAAATATGGG - Intergenic
1007230446 6:40344295-40344317 CAGAATGCTGATTGACATATAGG - Intergenic
1008070902 6:47097859-47097881 CAGAAAGCTGAGAGAAATCTGGG + Intergenic
1008170861 6:48203691-48203713 CAAAATGAAGATGGAAATGTTGG + Intergenic
1008284012 6:49627405-49627427 CAAAATGGTGATAGTGAGATGGG - Intronic
1008445829 6:51589355-51589377 ATAAAATCTGATAGAAATATTGG - Intergenic
1008887072 6:56443107-56443129 AATAATGCTGATATAAACATGGG - Intergenic
1009032656 6:58079044-58079066 TAAAATGCTTATACAAACATAGG + Intergenic
1009208265 6:60830811-60830833 TAAAATGCTTATACAAACATAGG + Intergenic
1009259880 6:61472224-61472246 CAAATTGCTGAATGAAATAGAGG - Intergenic
1009260790 6:61484373-61484395 CAAACTGCTGATTGAAAAAAAGG + Intergenic
1009558550 6:65207793-65207815 AAAAATGGTGATGGAAAAATTGG + Intronic
1009635004 6:66253751-66253773 CCAAATGCTGATAATGATATGGG - Intergenic
1010103586 6:72141069-72141091 CAAAATATTGTTGGAAATATTGG - Intronic
1010163813 6:72891834-72891856 CAAAAATCTGATAGTAATCTAGG + Intronic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1010682759 6:78816365-78816387 CAAAATGGTGGTAGAATAATTGG + Intergenic
1010927424 6:81760339-81760361 AAAAATGATGCTAGAAAAATGGG - Intergenic
1011228182 6:85130705-85130727 CCAACTGTTGATAGAAATTTGGG - Intergenic
1011754996 6:90489353-90489375 AATAATGCTGCTATAAATATGGG + Intergenic
1011796383 6:90958135-90958157 CTAAATGCTAGTAGAAATATGGG - Intergenic
1012015689 6:93847182-93847204 CAAAATGCTGATAGAAATTAAGG + Intergenic
1012056505 6:94418906-94418928 CAAAATAATGATAAATATATGGG - Intergenic
1012120993 6:95366685-95366707 CAAAATACTGATAGTGATATGGG - Intergenic
1012129647 6:95474330-95474352 CAAAATGAAGACAGAAATAAAGG + Intergenic
1012569001 6:100699691-100699713 CAAAATGCTGATAATGATTTGGG + Intronic
1012765499 6:103362467-103362489 CAAAATGCTCATAGTGATATGGG + Intergenic
1012771209 6:103437243-103437265 CAGAATGCTAATAGAGACATAGG - Intergenic
1013815651 6:114094459-114094481 CAAATTCCTGTTAGAAATGTAGG + Intronic
1013890608 6:115021850-115021872 CAAAATGCTGATAATGATATGGG - Intergenic
1014027141 6:116661966-116661988 CAAAATGCTCACTGAAATAAAGG + Intronic
1014137023 6:117902198-117902220 CATAGTGCTGAAAGGAATATAGG - Intergenic
1014698356 6:124652285-124652307 AGGAATGCTGGTAGAAATATGGG - Intronic
1015239511 6:131007621-131007643 CAAAATGCTGATAGTAATATGGG + Intronic
1015308978 6:131743949-131743971 CCAAATGCTATTGGAAATATTGG - Intronic
1015469671 6:133589823-133589845 AAAAATGCTGCTACAAACATTGG + Intergenic
1016600986 6:145860002-145860024 CAAAATGATGTTAGCAGTATAGG - Intergenic
1017966011 6:159266657-159266679 CAAAATTCTATTAGAAATCTAGG + Intronic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1020386932 7:7616801-7616823 AATAATGCTGCTATAAATATTGG - Intergenic
1020598390 7:10241422-10241444 ACAAATGTTGATAGAAAAATAGG - Intergenic
1020933269 7:14427337-14427359 CAAACTGCTGATAGTGATATGGG - Intronic
1021965040 7:25909295-25909317 CAATATGCTGGTATAAAAATTGG + Intergenic
1022021758 7:26406345-26406367 CAAAATCCTGACAGTAATTTGGG - Intergenic
1022678575 7:32523205-32523227 CAGAAGGATGATAGAAATTTGGG + Intronic
1023223178 7:37942165-37942187 AAAAATGCTGCTATAAACATAGG - Intronic
1023280679 7:38565846-38565868 CAAAAAGCTGATAAAACTAGGGG - Intronic
1024226347 7:47329038-47329060 CCAAATGCTGAAAAAAATGTGGG - Intronic
1024383614 7:48726149-48726171 CAATATGCTGATAATGATATGGG - Intergenic
1025529530 7:61861269-61861291 CAAACTGCTGAATGAAATGTAGG + Intergenic
1025550703 7:62244455-62244477 CAAACTGCTGAATGAAATAAAGG - Intergenic
1026490410 7:70858241-70858263 CAATATGCTGAAAGCAATATGGG - Intergenic
1027443283 7:78243304-78243326 CAAAATGTTAATAGCAATGTGGG + Intronic
1027789376 7:82620015-82620037 CAGAATGCTGATAGAAATACTGG + Intergenic
1028072559 7:86469767-86469789 CAGAATGGTGGTAGAAATCTAGG - Intergenic
1028102182 7:86834025-86834047 AATAATGCTGCTACAAATATTGG - Intronic
1028302047 7:89212161-89212183 CAAATTCCTGATGGAAATTTGGG - Intronic
1028676226 7:93465055-93465077 CTGAAAGCTGATAGAAATATAGG - Intronic
1028696424 7:93718030-93718052 TAAAATGGTGATAGCAATTTTGG + Intronic
1030043247 7:105470938-105470960 GAAAATGCTACTTGAAATATAGG + Intronic
1030689048 7:112514124-112514146 CAAAACTCTGATAGAGATAAAGG + Intergenic
1030781004 7:113600103-113600125 CAACGTTCTGATAGAAAAATAGG + Intergenic
1030805125 7:113907997-113908019 GAAAATGTTGCTAGAAATACTGG + Intronic
1031261928 7:119532438-119532460 CAAAATTCTGATAGTGATGTGGG + Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1031611579 7:123833947-123833969 CATAATACTGATATAAAAATAGG - Intronic
1031756570 7:125651274-125651296 AATAATGCTGCTATAAATATGGG - Intergenic
1032281626 7:130507656-130507678 CAATATACTGATAGCAAAATGGG + Intronic
1032616987 7:133483517-133483539 CAAAAAGTTAATTGAAATATGGG + Intronic
1032863903 7:135906774-135906796 AAAAATCCTGATGGTAATATGGG + Intergenic
1033107820 7:138545759-138545781 CAAAATGCTCAGAGAATAATGGG + Intronic
1033562429 7:142545177-142545199 CAAAATGATGATGGAGATGTAGG - Intergenic
1033880259 7:145872830-145872852 CAAGCTGCTAATAGAAATGTGGG - Intergenic
1033975369 7:147094243-147094265 CAGAATGTTGATAGAAATTTGGG - Intronic
1034348782 7:150403406-150403428 AGAAATGCTGCTAAAAATATGGG + Intronic
1034510823 7:151533198-151533220 CAAAATGCTGATAATGATATGGG - Intergenic
1034996869 7:155583034-155583056 GAGAATGTTGGTAGAAATATGGG + Intergenic
1036836623 8:12075362-12075384 AACAATGCTGAAAGAAATAAGGG - Intergenic
1036893878 8:12615122-12615144 CAAAATGCTGATGGTTATATGGG - Intergenic
1038812004 8:30856885-30856907 CAAAATTCTGATAGATTTGTTGG + Intronic
1038880541 8:31606076-31606098 CAAAATGCTGATAGTAATAAGGG - Intergenic
1039046588 8:33456055-33456077 AAAAATGCTGAGAGAGCTATTGG - Intronic
1039166437 8:34686574-34686596 TTAAATGTTGAAAGAAATATGGG + Intergenic
1039585661 8:38704997-38705019 GAAAATGCAGAAAGAAATCTTGG + Intergenic
1040398841 8:47026851-47026873 GAAAAAGAAGATAGAAATATAGG - Intergenic
1040540120 8:48346346-48346368 CAAAATGCTGATGGTGATAGGGG + Intergenic
1040692161 8:49952316-49952338 CAAAATCCTGATGAGAATATGGG + Intronic
1041113751 8:54513304-54513326 GAAAATGATGATAGAAACAGAGG + Intergenic
1041447793 8:57971807-57971829 CCAACTGCTGATAGACATCTGGG + Intergenic
1041898688 8:62957122-62957144 AAAAAGGCTGCTATAAATATCGG - Intronic
1041963755 8:63650239-63650261 CAAAATTCTCTCAGAAATATAGG + Intergenic
1042427497 8:68665224-68665246 CAAAATACAGATGGAAATATTGG + Intronic
1043308632 8:78829691-78829713 CAAAAACCTGATATAAAAATGGG + Intergenic
1043386934 8:79757964-79757986 AAAAATCCTGTCAGAAATATTGG + Intergenic
1043390640 8:79788091-79788113 CAAAAAGTTGATAGCAACATGGG + Intergenic
1043694665 8:83203887-83203909 CAAAATGCTGATGGTGATATGGG + Intergenic
1043755247 8:83995254-83995276 CACAATGCTGCTATGAATATGGG - Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044127104 8:88472209-88472231 CAAAATGCTGAGAGTGATATGGG - Intergenic
1044163603 8:88952028-88952050 GAAAATGCTGATATATAGATGGG + Intergenic
1044164626 8:88966871-88966893 CAGAATGTTGGTAGAAATATTGG + Intergenic
1044272480 8:90263733-90263755 TAAAGTGATGATATAAATATAGG - Intergenic
1045050589 8:98320677-98320699 CAAAATGCTGATAGCAATACGGG - Intergenic
1045097142 8:98809780-98809802 CATAATGCTGCTATGAATATAGG + Intronic
1045563570 8:103290397-103290419 CAACATGATGAGATAAATATTGG - Intergenic
1045724390 8:105155202-105155224 CAAAATACTGAGAAAAATACTGG - Intronic
1045849198 8:106673177-106673199 CAAAATGCTGATAGTGATAATGG + Intronic
1045998400 8:108390550-108390572 CAAAGTACTGATGGAAATATGGG + Intronic
1046134129 8:110004471-110004493 CAAAATGCTGATAGTGATGTGGG - Intergenic
1046668917 8:117036246-117036268 CAAAATGCTGACAGTGATATGGG - Intronic
1047060796 8:121222779-121222801 AAAAGTGCTGATAGAAATTAAGG - Intergenic
1048030101 8:130623079-130623101 CAAAATGCTCAAAGAATGATGGG - Intergenic
1048699932 8:137077441-137077463 CAAAATGTTGATAATGATATGGG + Intergenic
1048726231 8:137388068-137388090 CACAATGCTGATAGTGATATGGG - Intergenic
1048806452 8:138245905-138245927 CAAATTGCTGATAGTGATATGGG + Intronic
1050234923 9:3567739-3567761 AAATATGCTGAAAGAAATAAAGG - Intergenic
1050660210 9:7876197-7876219 CAAAATGCTTATAGTAATATGGG + Intronic
1050890625 9:10819845-10819867 AAAAATGCTGAGAGTGATATGGG - Intergenic
1050897368 9:10900201-10900223 CAAAATGATGATAGTGATATGGG - Intergenic
1051183156 9:14432299-14432321 CAACATTCAGAAAGAAATATGGG + Intergenic
1051229562 9:14941589-14941611 CAAAAACCTAATAGAAAAATTGG - Intergenic
1051569089 9:18535343-18535365 CAAAATGCTGATAGTGATACAGG - Intronic
1051573930 9:18593200-18593222 CAAACTGCTGCAAGAAATAAAGG - Intronic
1051946469 9:22575193-22575215 CAAAATTCTGAATAAAATATGGG + Intergenic
1052220715 9:26018288-26018310 TAAAATGCTGATAATGATATGGG - Intergenic
1052514912 9:29467844-29467866 CAAACTGCTAATAAAAATTTAGG - Intergenic
1052534310 9:29727853-29727875 CAAAAGAATCATAGAAATATGGG + Intergenic
1054363288 9:64201116-64201138 CAAATTGCTGAATGAAATAGAGG - Intergenic
1054363642 9:64206429-64206451 CAAACTGCTGATTGAAAAAAAGG + Intergenic
1054762680 9:69017194-69017216 TAAAATGCTGATTTAAAAATTGG + Intergenic
1055174510 9:73300395-73300417 CAAAATGCTGATAATGATACGGG - Intergenic
1055287678 9:74746664-74746686 GATAATTCTGATAGAAACATAGG + Intronic
1055641330 9:78320853-78320875 CTAAAAGCTAATAGAAAAATTGG - Intronic
1055840303 9:80495235-80495257 CAGAATGTTGGTAGAAATATGGG - Intergenic
1056262592 9:84863671-84863693 CAAAATGTTCACAGAAAAATGGG + Intronic
1056648782 9:88439616-88439638 AAAAAAGCTGATGGAACTATAGG - Intronic
1057285435 9:93749742-93749764 CAAACTGCTGATAGTGATATGGG - Intergenic
1058127692 9:101214608-101214630 AATAATGCTGATAGAATTAAAGG - Intronic
1058271459 9:102976696-102976718 CATAATGCTGGTAGAAATACAGG - Intergenic
1058433097 9:104936567-104936589 CAAAATGCTGAAAGAGAAAGAGG - Intergenic
1058480868 9:105394086-105394108 CAAAATGCTCATAGAATTTCAGG + Exonic
1058722156 9:107773933-107773955 CAAAATGCTGACAGTTATATGGG - Intergenic
1058779687 9:108320420-108320442 CAAAATGAAGATAGCTATATTGG + Intergenic
1059007246 9:110417079-110417101 CAAAATACTTATGGAAAAATTGG + Intronic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059582435 9:115566408-115566430 CAAAATGCTGATAATGATACAGG + Intergenic
1059631888 9:116133889-116133911 AATAATGCTGTTATAAATATGGG - Intergenic
1059917171 9:119116958-119116980 CAAAATGTTGATAGAAATATGGG + Intergenic
1060063840 9:120485255-120485277 CAAAATGTTTATAGATTTATTGG - Intronic
1062739067 9:138157305-138157327 GCAATTGCTCATAGAAATATGGG - Intergenic
1203635517 Un_KI270750v1:106856-106878 CAAAATGCTGATAATGATATGGG - Intergenic
1187772242 X:22712990-22713012 TAATCTGTTGATAGAAATATGGG - Intergenic
1188053064 X:25510192-25510214 CAAAATGCTGATAATGATAATGG - Intergenic
1188128294 X:26398715-26398737 CAGAATGTTAGTAGAAATATGGG + Intergenic
1188146920 X:26625537-26625559 CAAAGTGCACATAGAAAAATAGG - Intergenic
1188749163 X:33884559-33884581 CAAAATGCTGATGGTTATATGGG + Intergenic
1189071390 X:37867288-37867310 CAGAATGCTGATAGTGATATGGG - Intronic
1189637292 X:43024275-43024297 CAAAATGCTGATAATGATATGGG - Intergenic
1189872161 X:45395227-45395249 AAATATGCTGATAGTCATATTGG + Intergenic
1190118334 X:47640088-47640110 AAAAATACTGGTATAAATATTGG + Intronic
1190240841 X:48656811-48656833 CAGATTGGTGGTAGAAATATGGG - Intergenic
1190785173 X:53640042-53640064 AACAATGCTCATAGAAATCTTGG - Intronic
1190890890 X:54566747-54566769 AAAAATGCTGTTATGAATATGGG + Intergenic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1191724571 X:64266232-64266254 CAAAATACAGATTGAGATATGGG + Intergenic
1191760806 X:64646452-64646474 CAAAATGTTGATAGTAATATGGG + Intergenic
1192104439 X:68300361-68300383 CAAAATGCTAATAAAATTTTTGG - Intronic
1192374290 X:70543407-70543429 CAAAATGCACAGAGAAATTTTGG + Intronic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192866881 X:75143376-75143398 CAAAATGCTGATAATGATAATGG - Intronic
1192934990 X:75849954-75849976 AAAAATGCTGATAATGATATGGG - Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1193559907 X:83005859-83005881 CAATAAGATCATAGAAATATAGG + Intergenic
1193628088 X:83844291-83844313 CTAAATGCTGATAAAAATATGGG - Intergenic
1193866426 X:86737188-86737210 CAAAATGTGAATAGAATTATTGG + Intronic
1194025010 X:88740274-88740296 CACAATGGTGCTAGAAATGTGGG - Intergenic
1194064096 X:89240894-89240916 CAAAATGCTGATAGTGATAGGGG + Intergenic
1194464570 X:94217627-94217649 TAAAATCCTGATAAAAATTTGGG + Intergenic
1194712084 X:97247844-97247866 CAAAATGCTTAAATAAATAAAGG - Intronic
1195805869 X:108764395-108764417 CAGAATGTTGCTAGAAATGTGGG - Intergenic
1195872714 X:109502627-109502649 CTGAATATTGATAGAAATATGGG - Intergenic
1196028954 X:111074781-111074803 CAAAATGCTGATGGAGATGTGGG + Intronic
1196091653 X:111750591-111750613 AAAAATGCTGACAGAAATGAAGG - Intronic
1196309384 X:114144493-114144515 CAAGATACTGAAAGAAAAATTGG - Intergenic
1196945862 X:120825502-120825524 GAAAGTGCTGAGAGAAAAATAGG - Intergenic
1197204157 X:123775236-123775258 CTAAATGTTGATATGAATATAGG - Intergenic
1197385343 X:125795037-125795059 CAAAATGCTGATAGTAATATGGG + Intergenic
1197392302 X:125882939-125882961 CAAAATGCAGACAGTAATATGGG + Intergenic
1197494893 X:127166674-127166696 CAACATCCTGACAGAAAAATTGG + Intergenic
1197740790 X:129891967-129891989 TAAAATGCTGAAAGAAAGAAAGG + Intergenic
1197977872 X:132184583-132184605 CAAAATGCTTTCATAAATATTGG - Intergenic
1198213937 X:134539315-134539337 CAAAATGCTACTAAAAAGATAGG + Intergenic
1198569189 X:137937314-137937336 CAAAATGCTGATAGAAATATGGG + Intergenic
1198588470 X:138149197-138149219 CAAAATGCTGATAGAAATATGGG + Intergenic
1199309507 X:146306828-146306850 AAAACTGCTGATGGCAATATAGG + Intergenic
1199388998 X:147257723-147257745 CAAAATGCTGATAAGAAGTTGGG + Intergenic
1199840513 X:151642787-151642809 TAAAATGTTAATAGAAAAATTGG - Intronic
1200619447 Y:5423475-5423497 GAAAATGTTGCTATAAATATGGG - Intronic
1200718271 Y:6574993-6575015 CAAAATGCTGATAGTGATAGGGG + Intergenic