ID: 1077736923

View in Genome Browser
Species Human (GRCh38)
Location 11:4801083-4801105
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 725
Summary {0: 6, 1: 19, 2: 65, 3: 122, 4: 513}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077736923 Original CRISPR CAAAATGCTGATAGAAATAT GGG (reversed) Intronic