ID: 1077737142

View in Genome Browser
Species Human (GRCh38)
Location 11:4803485-4803507
Sequence GTTCTAACTCCATAAATGAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 100}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077737139_1077737142 -10 Left 1077737139 11:4803472-4803494 CCCGATCTGTTTGGTTCTAACTC 0: 1
1: 1
2: 0
3: 19
4: 165
Right 1077737142 11:4803485-4803507 GTTCTAACTCCATAAATGATGGG 0: 1
1: 0
2: 2
3: 13
4: 100
1077737136_1077737142 -3 Left 1077737136 11:4803465-4803487 CCCTGTCCCCGATCTGTTTGGTT 0: 1
1: 0
2: 0
3: 6
4: 76
Right 1077737142 11:4803485-4803507 GTTCTAACTCCATAAATGATGGG 0: 1
1: 0
2: 2
3: 13
4: 100
1077737138_1077737142 -9 Left 1077737138 11:4803471-4803493 CCCCGATCTGTTTGGTTCTAACT 0: 1
1: 0
2: 1
3: 3
4: 83
Right 1077737142 11:4803485-4803507 GTTCTAACTCCATAAATGATGGG 0: 1
1: 0
2: 2
3: 13
4: 100
1077737137_1077737142 -4 Left 1077737137 11:4803466-4803488 CCTGTCCCCGATCTGTTTGGTTC 0: 1
1: 0
2: 0
3: 7
4: 75
Right 1077737142 11:4803485-4803507 GTTCTAACTCCATAAATGATGGG 0: 1
1: 0
2: 2
3: 13
4: 100
1077737133_1077737142 16 Left 1077737133 11:4803446-4803468 CCACAACATCCTTGGATAACCCT 0: 1
1: 0
2: 0
3: 7
4: 118
Right 1077737142 11:4803485-4803507 GTTCTAACTCCATAAATGATGGG 0: 1
1: 0
2: 2
3: 13
4: 100
1077737134_1077737142 7 Left 1077737134 11:4803455-4803477 CCTTGGATAACCCTGTCCCCGAT 0: 1
1: 0
2: 0
3: 4
4: 68
Right 1077737142 11:4803485-4803507 GTTCTAACTCCATAAATGATGGG 0: 1
1: 0
2: 2
3: 13
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077737142 Original CRISPR GTTCTAACTCCATAAATGAT GGG Exonic