ID: 1077738791

View in Genome Browser
Species Human (GRCh38)
Location 11:4821562-4821584
Sequence GTTCACAGAGGACCACAAAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 242}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077738791 Original CRISPR GTTCACAGAGGACCACAAAC AGG (reversed) Exonic
902437333 1:16406948-16406970 CTTAACAAAGGACCACAGACTGG - Intronic
902909889 1:19587923-19587945 CATAACAAAGGACCACAAACTGG + Intergenic
903334260 1:22614392-22614414 GTACACAGAGGAAAACAGACAGG - Intergenic
905212897 1:36386325-36386347 CCTCACAGAGTTCCACAAACCGG - Intergenic
906167294 1:43696236-43696258 GGTCACTAAGTACCACAAACTGG + Intronic
907557780 1:55359615-55359637 TATCACAAAGCACCACAAACTGG - Intergenic
908538758 1:65103186-65103208 GTCCCCTGAGGCCCACAAACAGG - Intergenic
909704744 1:78568303-78568325 CTTAACAAAGCACCACAAACTGG - Intergenic
909989357 1:82203752-82203774 GTAAACAGAGAACCACAAAATGG - Intergenic
913737122 1:121797588-121797610 GTTCAAAGAGGTCCACATATCGG + Intergenic
913756589 1:122082294-122082316 GTTCAAAGAGGTCCACATATCGG - Intergenic
913766513 1:122197310-122197332 GTTCAAAGAGGTCCACATATCGG - Intergenic
915362891 1:155296297-155296319 TGTCACAGAGGACCACAGAATGG - Intronic
915501433 1:156321460-156321482 GGTCAAAGATGACCACCAACTGG + Intronic
916869432 1:168896537-168896559 ATTCAGAGAGAACCACAAAGAGG + Intergenic
917960644 1:180141659-180141681 CTTAACAAAGTACCACAAACTGG - Intergenic
918616958 1:186555750-186555772 GTTCACAGAAGACAGCAACCTGG - Intergenic
918753502 1:188305283-188305305 GTTGGCAGAGGACCAGAAAAAGG + Intergenic
919156122 1:193767818-193767840 GGTAACAAAGTACCACAAACTGG - Intergenic
919264651 1:195246885-195246907 GTTAACAGGGCACCAGAAACAGG + Intergenic
920918233 1:210276002-210276024 CATAACAGAGTACCACAAACTGG + Intergenic
922918118 1:229275468-229275490 CATCACAAAGAACCACAAACTGG - Intronic
923255468 1:232217977-232217999 GTGCAGAGAGGCCCACAAAGAGG + Intergenic
923656517 1:235921811-235921833 CTTAACAGAGAACCACCAACTGG - Intergenic
1064316073 10:14257896-14257918 TTTAGCAGATGACCACAAACTGG - Intronic
1064796353 10:19016084-19016106 TATAACAGAGTACCACAAACTGG - Intergenic
1065849784 10:29778174-29778196 CATCACAGAGTACTACAAACTGG - Intergenic
1066071624 10:31820440-31820462 GTTCACAGTGGACCTCAAGGGGG - Exonic
1066589742 10:36981540-36981562 GGTAACAAAGTACCACAAACTGG - Intergenic
1069840406 10:71336041-71336063 CTTCACCAAGTACCACAAACTGG + Intronic
1071473172 10:86001779-86001801 TCTAACAAAGGACCACAAACTGG + Intronic
1076344604 10:129771876-129771898 GTACACACAGCACCACACACGGG + Intergenic
1076424620 10:130358868-130358890 GGTCTCAGAGGACAACAAAGAGG - Intergenic
1077738791 11:4821562-4821584 GTTCACAGAGGACCACAAACAGG - Exonic
1078161729 11:8846094-8846116 GTCCACAGAGCAACACAGACAGG + Intronic
1078369069 11:10730152-10730174 GTGCACAGAGGACAGCAAAGTGG - Intergenic
1079056803 11:17213298-17213320 CATAACAGAGGACCACAAACTGG + Intronic
1079103518 11:17556379-17556401 TTTCACAAAGGACCACAGTCTGG - Intronic
1081562519 11:44230800-44230822 GTTAACAAAGAACCACAAATTGG - Intronic
1083336118 11:61922841-61922863 GATCAGAGAGGAGCAAAAACAGG - Intergenic
1086756385 11:90568487-90568509 GCTCAAAGAGAACCACATACTGG + Intergenic
1087249274 11:95877923-95877945 AATAACAGAGTACCACAAACTGG - Intronic
1087627408 11:100611605-100611627 GTAAACAGAGGAACAAAAACTGG + Intergenic
1087637288 11:100716308-100716330 CTTCACAGTGAACCACAAGCAGG - Intronic
1089011796 11:115137463-115137485 GGTGACACAGGACCACCAACTGG + Intergenic
1090036231 11:123251980-123252002 TGTAACAGAGTACCACAAACTGG - Intergenic
1090882208 11:130843463-130843485 GTCCACTGAGGACAACAAAATGG - Intergenic
1092201253 12:6585119-6585141 GTTTACAGAGGACAAGAAAAAGG + Intronic
1093763592 12:22937684-22937706 TGTAACAGAGTACCACAAACTGG - Intergenic
1095967108 12:47876119-47876141 GTTCACAAATGACCACAAAGGGG + Intronic
1097548132 12:61030583-61030605 TTTCACAGACTACCCCAAACTGG - Intergenic
1100930921 12:99608712-99608734 GAAGACAGAGGACCACAAAAAGG + Intronic
1101899726 12:108782427-108782449 GTACACAAAGGACCACCCACAGG + Intergenic
1103166376 12:118773811-118773833 TGTAACAGATGACCACAAACTGG - Intergenic
1105643826 13:22295063-22295085 TTTAACAGAATACCACAAACTGG - Intergenic
1106650632 13:31686435-31686457 CATCACAAAGTACCACAAACTGG + Intergenic
1106907077 13:34420420-34420442 TGTCACAAAGCACCACAAACTGG + Intergenic
1107658094 13:42612431-42612453 GATAACAAATGACCACAAACTGG + Intergenic
1107759880 13:43666678-43666700 CTTAACAAAGCACCACAAACTGG - Intronic
1107972750 13:45659900-45659922 GTTCACAGAGGACAAAAAAAGGG - Intergenic
1108522354 13:51257905-51257927 TTTAACATAGTACCACAAACTGG + Intronic
1108715353 13:53073126-53073148 GTTTGGAGAGGACCAGAAACAGG + Intergenic
1109492813 13:63126167-63126189 CTTAACAGAGGACCACAAACTGG + Intergenic
1111099170 13:83558906-83558928 TTTGACAAAGTACCACAAACTGG - Intergenic
1113096315 13:106667498-106667520 CATCACAGAAGACCACAGACTGG + Intergenic
1113360166 13:109623198-109623220 TGTCACAAATGACCACAAACTGG - Intergenic
1114402238 14:22420640-22420662 CTTAACAAAGTACCACAAACTGG - Intergenic
1116858722 14:49976722-49976744 ATACACAGAGGGCCACAAGCTGG + Intergenic
1117444071 14:55787057-55787079 TGTAACAGAGTACCACAAACTGG + Intergenic
1117916974 14:60687972-60687994 GTACAGAGAGGAGCAGAAACTGG + Intergenic
1119307065 14:73616030-73616052 GATCACAGGTCACCACAAACTGG + Intronic
1119972495 14:78987220-78987242 GTTCTCAGACGACCACAACCTGG - Intronic
1120418798 14:84255577-84255599 TTTAACAAAGGACCACAAACTGG - Intergenic
1121327696 14:93031103-93031125 TGTCACAAAGGGCCACAAACTGG - Intronic
1121800383 14:96769469-96769491 TGTCACAAAGCACCACAAACTGG + Intergenic
1122394595 14:101414623-101414645 CGTGACAGATGACCACAAACTGG - Intergenic
1122632216 14:103112234-103112256 GTTCCCAGAGGCCCACCTACGGG + Intergenic
1122687479 14:103516677-103516699 GTTCAGAGAGGAAGACAGACCGG - Intergenic
1122725904 14:103752012-103752034 GGTCACAAAGGACCGCATACAGG + Intronic
1123976931 15:25562701-25562723 GTTAACATAGTACCACAACCGGG + Intergenic
1124606477 15:31173214-31173236 CTTAACAAAGGACCACAGACTGG + Intergenic
1124711281 15:32014346-32014368 GTTCACAGAGAAACACACACTGG + Intergenic
1125286960 15:38103692-38103714 GTCCAGCGAGGACCACAACCTGG - Intergenic
1130671177 15:85914250-85914272 GGTAACAGAGTTCCACAAACTGG + Intergenic
1131173867 15:90197795-90197817 GTTTACAGATGACCCCATACTGG + Intronic
1132999995 16:2845204-2845226 TTTCACTGAGGACCCCATACAGG - Intergenic
1133741920 16:8658357-8658379 GGTAACAAATGACCACAAACTGG - Intergenic
1136135061 16:28251027-28251049 GTTCATAGAGGACAAATAACTGG + Intergenic
1136286825 16:29249025-29249047 TGTAACAGAGGACCACACACCGG + Intergenic
1136692004 16:32039315-32039337 GGTCACAGAGAACCACAAGGGGG + Intergenic
1139670809 16:68491598-68491620 GTCCACAGACGACCTCAAAATGG + Intergenic
1140460891 16:75138877-75138899 CATCACAAAGGACCACATACTGG - Intergenic
1142092424 16:88221660-88221682 TGTAACAGAGGACCACACACCGG + Intergenic
1142672603 17:1493989-1494011 TTTCCCACAGGACCAGAAACAGG - Intergenic
1148324942 17:46777820-46777842 GTTCTCAGAGGACATCACACTGG - Intronic
1151549899 17:74816278-74816300 TATCACAGATGACCACAAACTGG - Intronic
1152256746 17:79244437-79244459 CGTAACAGATGACCACAAACTGG - Intronic
1152390353 17:80000584-80000606 TGTGACAAAGGACCACAAACCGG - Intronic
1154006092 18:10528376-10528398 GTTAACAGAGGACTAAAAATAGG + Intronic
1155352984 18:24924927-24924949 GTTCATGGAGGACCTAAAACAGG + Intergenic
1155521326 18:26671795-26671817 GTTCACAGAGCAGCCCAAACAGG - Intergenic
1155591520 18:27433107-27433129 TATCACAGAATACCACAAACTGG - Intergenic
1156189822 18:34705390-34705412 TTTCACAGATGACATCAAACTGG + Intronic
1157084392 18:44564123-44564145 TGTAACAGAGTACCACAAACTGG - Intergenic
1157744866 18:50126464-50126486 AATCACAGGGGACCACAAAGTGG + Intronic
1158268972 18:55692037-55692059 GTGAAAAGCGGACCACAAACAGG - Intergenic
1159241860 18:65751484-65751506 CCTCAAAGAGGACCACAAGCAGG + Intronic
1159776349 18:72607272-72607294 CTTAACAAAGTACCACAAACTGG - Intronic
1161437433 19:4272298-4272320 TTTCACAGAACACCACAGACTGG + Intergenic
1162222681 19:9191591-9191613 GGTGACAGATGGCCACAAACCGG - Intergenic
1162229189 19:9251460-9251482 GGTGACAGATGGCCACAAACCGG - Exonic
1162230444 19:9261515-9261537 GGTGACAGATGTCCACAAACCGG + Intergenic
1163069573 19:14827857-14827879 GGTGACAGATGGCCACAAACCGG + Exonic
1163071017 19:14841493-14841515 GGTGACAGATGGCCACAAACCGG + Exonic
1163073293 19:14864331-14864353 GGTGACAGATGGCCACAAACTGG + Intergenic
1163076016 19:14892420-14892442 GGTGACAGATGGCCACAAACCGG + Intergenic
1163077123 19:14903789-14903811 GGTGACAGATGGCCACAAACTGG + Intergenic
1163078329 19:14916777-14916799 GGTGACAGATGGCCACAAACTGG - Intergenic
1163079533 19:14927474-14927496 GGTGACAGATGGCCACAAACCGG - Intergenic
1166743890 19:45130732-45130754 GTTCACAGAGCACCAGAGTCAGG - Intronic
1167533115 19:50031299-50031321 GTTCCCAGAAGAGTACAAACAGG - Intronic
1168380046 19:55912640-55912662 GTTCACAGGGGACGACCTACGGG - Exonic
1168629571 19:57946632-57946654 GTGCACAGTGGGGCACAAACTGG - Intronic
925666030 2:6257237-6257259 AATAACAGATGACCACAAACTGG - Intergenic
930052601 2:47228299-47228321 GTTCACAGAGGCCTTCAAGCAGG + Intergenic
930850018 2:55950650-55950672 GCTCACAGAGGACCAGTACCAGG - Intergenic
931261155 2:60620473-60620495 CTTAACAAAGTACCACAAACTGG - Intergenic
931751190 2:65331581-65331603 GTTCACAGAAGACTCCAAATAGG + Intronic
932297589 2:70640014-70640036 TGTAACAGAGCACCACAAACTGG + Intronic
932849182 2:75167292-75167314 GTTCACATAGGAAAATAAACTGG + Intronic
936060483 2:109292674-109292696 GTGCTGAGAGGAGCACAAACCGG + Intronic
937243890 2:120479931-120479953 GTTCACAGAAGACCAAACACAGG - Intergenic
938697891 2:133851135-133851157 GCTCACAGATGACCAGAAGCAGG + Intergenic
939742156 2:145921876-145921898 GGTAACAAAGGACCACAGACTGG - Intergenic
939836645 2:147137305-147137327 ATTAACAAAGAACCACAAACTGG + Intergenic
940060310 2:149558698-149558720 TTTGACAGAATACCACAAACTGG + Intergenic
941645114 2:168031811-168031833 CTTAACAAAGAACCACAAACTGG - Intronic
942254027 2:174074228-174074250 GATCACAGAAGAGCACAAAAGGG + Exonic
942378030 2:175356870-175356892 GTTAACAAAGTACCTCAAACTGG + Intergenic
943263270 2:185693589-185693611 ATTAACAAAGTACCACAAACTGG - Intergenic
943533971 2:189123560-189123582 GATAACAAAGTACCACAAACTGG - Intronic
944315036 2:198275648-198275670 TGTAACAGAGTACCACAAACTGG + Intronic
946782608 2:223206242-223206264 GTTCTTGGAGGACTACAAACTGG + Intergenic
947414508 2:229880014-229880036 GTTCACAGAGGAACACTGCCGGG - Exonic
947709434 2:232303277-232303299 GGAAACAGAGGAACACAAACAGG - Intronic
947736223 2:232456816-232456838 GATCCCAGAGGACCAGAACCAGG + Intronic
948147906 2:235722219-235722241 GGTAACAAAGTACCACAAACTGG + Intronic
949049103 2:241887758-241887780 GTTAACAAGGTACCACAAACCGG + Intergenic
1170116971 20:12871007-12871029 ATTCCCAGTGGACCACACACTGG - Intergenic
1173068206 20:39735398-39735420 TTTTACAAAGGACCACAGACTGG - Intergenic
1173637884 20:44576932-44576954 GTCCAAAGGGGACCACAAAGTGG + Intronic
1174466551 20:50722156-50722178 GTTCACAAAGTACCACACGCTGG - Intergenic
1175047234 20:56118643-56118665 GCAAACAGAGTACCACAAACTGG + Intergenic
1176407366 21:6428448-6428470 GGACACAGAGGACCATTAACAGG + Intergenic
1177866507 21:26518967-26518989 GTTTGCAGTGGATCACAAACAGG - Intronic
1178440042 21:32591324-32591346 GGTCACAGAGGACCTCATTCAGG - Intronic
1178750615 21:35299220-35299242 TATCCCAGAGTACCACAAACTGG - Intronic
1178940506 21:36901454-36901476 TGTCACAAAGGACTACAAACCGG + Intronic
1179056978 21:37945206-37945228 TCTCACTGAGGACCACACACAGG + Intergenic
1179108436 21:38424371-38424393 CTTCACAGAGCCCCACAGACTGG - Intronic
1179469146 21:41598882-41598904 GGTGACAAAGGACCACAAAACGG - Intergenic
1179682874 21:43036851-43036873 GGACACAGAGGACCATTAACAGG + Intergenic
1180117664 21:45721738-45721760 TTTCACAGAGGTCCATAGACAGG + Intronic
1181870305 22:25892928-25892950 CTTAACAGAGGAAAACAAACTGG - Intronic
1181925382 22:26354494-26354516 CTTGACAAAGGACCACAAACCGG - Intronic
1185226926 22:49658462-49658484 CGTGACAAAGGACCACAAACTGG + Intergenic
950973955 3:17220436-17220458 GTTCACAAAGGACCTTAAAGCGG - Intronic
955694781 3:61624852-61624874 CATAACAAAGGACCACAAACTGG + Intronic
956717369 3:72090140-72090162 TGTGACAAAGGACCACAAACTGG + Intergenic
959533068 3:107455717-107455739 ATTCATAGAGGACAACAAACAGG + Intergenic
959769769 3:110079324-110079346 GTTCACTGAGAACCATAAAAGGG + Intergenic
959889763 3:111541397-111541419 ATTTACAGAGAACCGCAAACAGG - Intronic
960122205 3:113958380-113958402 GATCACAGAGTACCACACGCAGG - Exonic
960851559 3:122060039-122060061 GGTAACAAAGTACCACAAACTGG - Intronic
961068992 3:123903572-123903594 GTTCATAGAAGACCCCAAACTGG + Intronic
962946107 3:140172564-140172586 TGTAACAGAGTACCACAAACTGG + Intronic
964431282 3:156608868-156608890 TTTTACAAAGCACCACAAACTGG - Intergenic
964646673 3:158965839-158965861 TTTTACAAAGTACCACAAACTGG + Intronic
965673752 3:171173692-171173714 TTCCACAGAGGAGGACAAACTGG - Intronic
968680877 4:1918587-1918609 TTTGACAGAAGACCAAAAACTGG - Exonic
968970142 4:3789519-3789541 CTTCACAGATGATCACAAACTGG - Intergenic
974546535 4:63315735-63315757 GGTAACAAAGCACCACAAACTGG + Intergenic
974795219 4:66740355-66740377 TTTATCAGAGGACCACAATCTGG - Intergenic
975402963 4:73958575-73958597 CTTCAAGGAGAACCACAAACCGG + Intergenic
976224911 4:82788248-82788270 TATAACAGAGTACCACAAACTGG - Intronic
976986720 4:91309853-91309875 CATAACAGAGGGCCACAAACTGG + Intronic
977104434 4:92863298-92863320 GTACAGAGAGGAGCACAAAGAGG - Intronic
978412104 4:108436906-108436928 GTTCATATGGGACCAAAAACGGG - Intergenic
978611458 4:110545640-110545662 GTTCAGAGAGGACCAAAAGTAGG - Intronic
980500784 4:133650077-133650099 GATCACAGAGACACACAAACAGG - Intergenic
981983158 4:150821851-150821873 ATTCACAAAGGCCCACAACCTGG + Intronic
984539898 4:181024441-181024463 CATAACAAAGGACCACAAACTGG + Intergenic
985150843 4:186945665-186945687 GTTCAGAGAGGAGCAAAATCAGG + Intergenic
986100167 5:4600830-4600852 TGTCACAGAGTACCACAAATTGG - Intergenic
986668730 5:10125401-10125423 GTCAACAAAGTACCACAAACTGG - Intergenic
987339208 5:16924287-16924309 GTTCACAGAAGACCTAAAAATGG + Intronic
988906651 5:35797588-35797610 GTTCCAAGAGTACCACACACAGG - Intronic
989315217 5:40070528-40070550 TATAACAGAGTACCACAAACTGG - Intergenic
992905067 5:81337788-81337810 TATAACAGAGGACCACAAACTGG - Intronic
994035751 5:95198744-95198766 CTTTACAGAGTACCACAAAATGG + Intronic
996506572 5:124274987-124275009 GCTAACAAAGTACCACAAACAGG + Intergenic
996780413 5:127180763-127180785 GTACACAGAAGACGACAAAAGGG + Intergenic
997429275 5:133826350-133826372 CATAACAAAGGACCACAAACTGG + Intergenic
1000212583 5:159121009-159121031 CATAACAGAGTACCACAAACTGG + Intergenic
1002434427 5:179222094-179222116 GTTCACACAGGAAGACAAATGGG - Intronic
1004484295 6:16051488-16051510 GGTCACAGAGGGCTAGAAACGGG - Intergenic
1004687010 6:17956395-17956417 AATCAGGGAGGACCACAAACAGG - Intronic
1005810084 6:29508690-29508712 AATAACAGAGGACCACAAACTGG + Intergenic
1007367936 6:41407641-41407663 GTTCCCAGAGGAGCTGAAACTGG - Intergenic
1007526774 6:42502887-42502909 CATCACAAAGTACCACAAACTGG - Intergenic
1010859843 6:80897222-80897244 AGTCACAGAGGACCAAGAACTGG + Intergenic
1011529015 6:88299617-88299639 CATCACAAAGTACCACAAACTGG + Intergenic
1011878886 6:91998004-91998026 GTTAACAGAGTACTATAAACTGG - Intergenic
1015676593 6:135756791-135756813 GTTCACAGACAGCAACAAACAGG + Intergenic
1016180051 6:141134690-141134712 TTACACAGAGGACAACATACTGG + Intergenic
1016443641 6:144110152-144110174 GCTCACAGAGGAGTCCAAACAGG - Intergenic
1017594944 6:156018286-156018308 TATAACAAAGGACCACAAACCGG + Intergenic
1018014517 6:159699888-159699910 GTTCTCAGTGGACCACAATCTGG - Intronic
1018082526 6:160270723-160270745 GGTGACAAAGGACCGCAAACTGG - Intronic
1018394309 6:163365802-163365824 GGTTACAGAAGACCACACACAGG - Intergenic
1019363635 7:619016-619038 CATCACAGAGCACCACAGACTGG + Intronic
1020578968 7:9970880-9970902 GTTCACAGATTACCTGAAACTGG + Intergenic
1021652343 7:22844490-22844512 TATAACAGAGGACCACAGACTGG + Intergenic
1022186750 7:27976667-27976689 GCTCTCAGAAGACCATAAACAGG + Intronic
1022387927 7:29918764-29918786 CGTCACAAAGTACCACAAACTGG - Intergenic
1022392221 7:29953105-29953127 GTTCACAGATTATCACAGACTGG - Intronic
1025617186 7:63130873-63130895 GTTTACAGAAGACCAAATACTGG - Intergenic
1025956851 7:66189731-66189753 CATAACAGATGACCACAAACTGG - Intergenic
1027223048 7:76226218-76226240 GGACACAGTGGGCCACAAACTGG - Intronic
1028923018 7:96327468-96327490 TTTAACAGAGTACCACAAACTGG - Intergenic
1029942029 7:104490611-104490633 GTATACAGAGAACCACAAAAGGG + Intronic
1030178458 7:106679155-106679177 TCTTACGGAGGACCACAAACTGG - Intergenic
1031297974 7:120027965-120027987 GTTCATATAGAACCACAAAAGGG - Intergenic
1031396033 7:121275390-121275412 GTTTACATAGGACAACAAACAGG + Intronic
1033544443 7:142387255-142387277 ATCCTCAGAGGACCTCAAACAGG - Intergenic
1034398978 7:150848881-150848903 TGTCACAGAGGACCACACACAGG - Intronic
1035085607 7:156254949-156254971 GGTAACAGAGGACCACAGATGGG - Intergenic
1038851277 8:31279442-31279464 GTTCTCAGAGGTGCACAATCAGG - Intergenic
1041348729 8:56928243-56928265 TGTTACAAAGGACCACAAACTGG - Intergenic
1042120820 8:65486257-65486279 GTTCAGAGAAGGCCAAAAACCGG - Intergenic
1044639159 8:94360364-94360386 GTTCAGAGAGGCCCATAACCTGG + Intergenic
1047186838 8:122640951-122640973 GAACACAGAGAACCACACACTGG - Intergenic
1047360712 8:124166366-124166388 GGGCACAGAGGACCATAAACAGG + Intergenic
1049108926 8:140630776-140630798 GCTGAAAGAGGACCACAAAAAGG + Intronic
1049738168 8:144221136-144221158 GGTCACAGAGCATCACAACCAGG + Intronic
1050334461 9:4577134-4577156 GTTCACAGAGGACTCCAGAGAGG + Intronic
1050417114 9:5429392-5429414 CATAACAAAGGACCACAAACTGG + Intronic
1050683872 9:8145484-8145506 CATCACAAAGTACCACAAACTGG - Intergenic
1051481708 9:17568954-17568976 TGTAACAGAGGACCACAAACTGG - Intergenic
1051775724 9:20631386-20631408 GTTTACAGAGTACCACAACTTGG - Intergenic
1055380220 9:75698613-75698635 CTTCACAAATGATCACAAACTGG + Intergenic
1058669929 9:107352226-107352248 TTTCCCAGAGGACCACAAAGTGG + Intergenic
1060461559 9:123859936-123859958 GGTGACAGAGGACCACAGAAAGG + Intronic
1062483086 9:136761584-136761606 CATCACAGAGTACCACAAATGGG - Intronic
1185669294 X:1792919-1792941 GTTCTCAGAGGACCCCATCCAGG - Intergenic
1185872027 X:3672668-3672690 ATTAACAAAGTACCACAAACTGG + Intronic
1186233261 X:7479210-7479232 GGCCAAAGAGGACCTCAAACAGG + Intergenic
1186636360 X:11409374-11409396 GTTCACTCAGGAGCACAAGCAGG + Intronic
1189597292 X:42582903-42582925 GTTCACAAAGAAGCAGAAACAGG + Intergenic
1191155537 X:57268639-57268661 GTTAACAGTGGACCTCTAACTGG + Intergenic
1194465202 X:94225925-94225947 TATAACAGAGTACCACAAACTGG - Intergenic
1195741833 X:108072703-108072725 GTTCAAGGAAGACCAGAAACTGG + Exonic
1197688357 X:129468891-129468913 GTTCACAGGGTTTCACAAACTGG - Exonic
1199968784 X:152843341-152843363 TGTAACAGATGACCACAAACTGG + Intronic
1201370682 Y:13259972-13259994 GTACACAGATGCCTACAAACAGG - Intronic
1201929463 Y:19326524-19326546 TTTCAAAGAGGACTCCAAACCGG + Intergenic