ID: 1077740059

View in Genome Browser
Species Human (GRCh38)
Location 11:4835758-4835780
Sequence CTATAAAATGAGGTGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 233}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077740054_1077740059 4 Left 1077740054 11:4835731-4835753 CCACAGGCCAAAGTTGCAGCTTT 0: 1
1: 0
2: 0
3: 15
4: 206
Right 1077740059 11:4835758-4835780 CTATAAAATGAGGTGGAGCTGGG 0: 1
1: 0
2: 4
3: 22
4: 233
1077740052_1077740059 21 Left 1077740052 11:4835714-4835736 CCATTCAAAGGTGCTTTCCACAG 0: 1
1: 0
2: 1
3: 15
4: 136
Right 1077740059 11:4835758-4835780 CTATAAAATGAGGTGGAGCTGGG 0: 1
1: 0
2: 4
3: 22
4: 233
1077740055_1077740059 -3 Left 1077740055 11:4835738-4835760 CCAAAGTTGCAGCTTTCTGTCTA 0: 1
1: 0
2: 1
3: 18
4: 166
Right 1077740059 11:4835758-4835780 CTATAAAATGAGGTGGAGCTGGG 0: 1
1: 0
2: 4
3: 22
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077740059 Original CRISPR CTATAAAATGAGGTGGAGCT GGG Intronic
901823847 1:11847791-11847813 CTATAAAAAGAGGCGGCACTGGG - Intronic
901950727 1:12743833-12743855 ATATTAAATGAGGTGGAATTTGG - Intergenic
901974578 1:12933982-12934004 TTACAAAGTGAGGTGGAGGTTGG - Intronic
902010595 1:13267785-13267807 TTACAAAGTGAGGTGGAGGTTGG + Intergenic
904864508 1:33567810-33567832 ATAGAAAATGGAGTGGAGCTTGG + Exonic
912447989 1:109751953-109751975 CTAGAAAAGGAGGTGGTGGTTGG - Intronic
913097327 1:115531285-115531307 AAATAATATGTGGTGGAGCTAGG + Intergenic
913343867 1:117788287-117788309 CTATAATGTGAGGTGGACATGGG + Intergenic
913482289 1:119300295-119300317 CTATGAAATGAGATGCAACTTGG + Intergenic
913494514 1:119415964-119415986 CTATAAAATGAAATGAAGCCTGG - Intronic
913556314 1:119970736-119970758 CTATAAAATAAAGTGGTGATTGG + Intronic
914094522 1:144533364-144533386 CATTAAAATGAGGTGGAAATTGG - Intergenic
914252061 1:145929659-145929681 CTTAAAAATGAGGTCGAACTCGG - Intergenic
914304000 1:146400523-146400545 CATTAAAATGAGGTGGAAATTGG + Intergenic
915074746 1:153298887-153298909 ATATAAAGCAAGGTGGAGCTGGG + Intronic
915494134 1:156269263-156269285 TTAAAAAATGAGCTGGGGCTGGG - Intronic
917153256 1:171966762-171966784 CATTAAAATGAGGTGGAATTTGG + Intronic
917229383 1:172819623-172819645 CTCTAGATTGAGGTGGATCTTGG + Intergenic
918075292 1:181166375-181166397 CTGTAAGATGAGGTAGAGCTAGG - Intergenic
918299410 1:183189014-183189036 TTAGAGAATGAAGTGGAGCTAGG + Intronic
918541001 1:185633063-185633085 CATTAAAATGAGGTGGAATTTGG - Intergenic
919597171 1:199578626-199578648 ATCTAACAGGAGGTGGAGCTCGG - Intergenic
923120826 1:230989430-230989452 ATATAAAGTGAGGAAGAGCTGGG - Intronic
923186313 1:231576956-231576978 CAATAAGATGAAGTGGAGCAAGG - Intronic
924925840 1:248679188-248679210 GTATAAAATTAGGAGAAGCTGGG + Intergenic
1062820017 10:527930-527952 CTACATAATTACGTGGAGCTGGG - Intronic
1063622115 10:7659079-7659101 TTCTAAAATGAGGTGAGGCTGGG + Intronic
1066102185 10:32127425-32127447 AAATAAAATGAGGAGGAACTTGG + Intergenic
1067715726 10:48689962-48689984 CTTTAAAATCAGGTGGAACTAGG - Intronic
1068798750 10:61115047-61115069 CTGTAGATTGAGGTGGAGATAGG + Intergenic
1072344940 10:94495317-94495339 CTAAAAAATGAGCTGGGGCTGGG - Intronic
1073973979 10:109078365-109078387 GTATCAAAAAAGGTGGAGCTAGG - Intergenic
1074485321 10:113871463-113871485 CAATAAATTGAGGTGGGGCGTGG - Intronic
1077740059 11:4835758-4835780 CTATAAAATGAGGTGGAGCTGGG + Intronic
1077881242 11:6352260-6352282 CTTTAGAATGAGGTGGAGAAAGG + Intergenic
1079305968 11:19322335-19322357 CTCTAAAATGAGGAGTAGATTGG + Intergenic
1084270347 11:68026191-68026213 CTCTACATTGAGGTGGGGCTGGG - Intronic
1084391211 11:68878369-68878391 CTTTAAAATGAGGTGGAATGTGG + Intergenic
1084631039 11:70349995-70350017 CTATAGCATGGGGTGGAACTGGG - Intronic
1086841621 11:91692449-91692471 TTAAAAGATGAGGTGGAGCAAGG - Intergenic
1086915255 11:92522769-92522791 CATTAAAATGAGGTGGAATTTGG - Intronic
1086983462 11:93223771-93223793 GTATAAACTGAGGTGGTCCTGGG + Intergenic
1087037080 11:93766543-93766565 CATTAAAATAAGGTGGAACTTGG + Intronic
1088170024 11:106985960-106985982 CTATAAAATCAGGTTGACCTGGG + Intronic
1090265279 11:125349586-125349608 GAAGAAAATGAGGTGGAGGTGGG - Intronic
1092019164 12:5186039-5186061 CCACAAAATGAGATTGAGCTTGG - Intergenic
1093698524 12:22190991-22191013 CATTAAAATGAGGTGGAATTTGG + Intronic
1093943684 12:25083710-25083732 CAATAAATTAAGGTGGAGCTAGG - Intronic
1096482076 12:51948982-51949004 GTGGAAAATGAGGTGGAGCAGGG - Intergenic
1097998722 12:65918340-65918362 TTATAAAGAGAAGTGGAGCTTGG + Intronic
1098740981 12:74172777-74172799 CTAAAAAAGGAGGTGGAGTCTGG - Intergenic
1100978825 12:100148527-100148549 CTATAAAATGAGTTTAGGCTGGG + Intergenic
1102062963 12:109948375-109948397 CTCTAAAATGGGGTGGTGCCAGG - Intronic
1103774268 12:123354645-123354667 TTGTAAAATGAGGAGGAGATTGG - Intronic
1104202316 12:126601704-126601726 CAATAAAATGATGTGAATCTGGG - Intergenic
1105399116 13:20072222-20072244 TCATAAAATGAGTTGGGGCTGGG + Intronic
1107535854 13:41330673-41330695 CTATAAAATTAGGTGTCTCTTGG + Intronic
1107889131 13:44898775-44898797 TTCTAGAAGGAGGTGGAGCTTGG - Intergenic
1110600905 13:77372663-77372685 CATTAAAATGAGGTGGAATTTGG - Intergenic
1111657528 13:91172648-91172670 ATATCAAATGAGGTAGAGATTGG - Intergenic
1111793195 13:92884804-92884826 CTATAAAGAGAGTTGCAGCTTGG + Intergenic
1112031733 13:95462717-95462739 ATTTAGAATGAGGTGGAACTTGG - Intronic
1112480898 13:99774479-99774501 CTAGACAATGAGGTTGGGCTGGG + Intronic
1113114181 13:106857419-106857441 CATTAAAATGAGGTGGAATTTGG - Intergenic
1113450332 13:110404834-110404856 TTCTAAAATGAGTTGGGGCTGGG + Intronic
1114458812 14:22873936-22873958 CAGTGAATTGAGGTGGAGCTGGG + Intronic
1115226411 14:31107243-31107265 CTAAAAAATTAGGTTGATCTTGG - Exonic
1116715362 14:48419235-48419257 TTCTAGAATGTGGTGGAGCTGGG + Intergenic
1119037364 14:71241687-71241709 ACATAGGATGAGGTGGAGCTGGG - Intergenic
1119102562 14:71893764-71893786 CTTTAAAATGAGGGGGAATTTGG + Intergenic
1120313924 14:82867123-82867145 CTATAGGTTGAAGTGGAGCTGGG - Intergenic
1121238236 14:92409064-92409086 CTATAGAAAGAGGTGGGACTGGG + Intronic
1122485280 14:102075445-102075467 CTATAAAATAAAGTGGGGCCGGG + Intergenic
1124032258 15:26022337-26022359 CATTAAAATGAGGTGGAATTTGG + Intergenic
1126485429 15:49175154-49175176 CATTAAAATGAGGTGGAATTTGG + Intronic
1127590772 15:60420424-60420446 CTAGAGAATGCGATGGAGCTGGG - Exonic
1128328640 15:66741481-66741503 CTGTAAAATGAGGAGGAGGTGGG + Intronic
1129617958 15:77114754-77114776 GGATAAGATGAGGTGGGGCTGGG + Exonic
1131429698 15:92376971-92376993 CAAAAAAAAGAGGTGGAGGTGGG + Intergenic
1131619037 15:94047491-94047513 CTATAAAATCTGTTGGAGATGGG + Intergenic
1131685527 15:94763495-94763517 CTATATAACAAGGTGCAGCTAGG + Intergenic
1134806900 16:17133760-17133782 CTAGAAGATGAGGGGGAGGTAGG - Intronic
1135020513 16:18959015-18959037 CAATAAAATGAGGTGGAATTTGG - Intergenic
1135054866 16:19223039-19223061 CTACAGAATGAAGTGGAGCTGGG + Exonic
1138734648 16:59236464-59236486 CTATAGAAAGAAGGGGAGCTTGG - Intergenic
1138933497 16:61690977-61690999 CTATAAAGTGAGGAGCAGCCTGG - Intronic
1139007868 16:62595565-62595587 CATTAAAATGAGGTGGAATTTGG - Intergenic
1139340652 16:66265879-66265901 CTATAAGATGAGGTGGGGCCGGG + Intergenic
1139940568 16:70602370-70602392 CTTTAAAATGAGGGTGAGCCGGG + Intronic
1143427250 17:6849657-6849679 CAAGAAAATGAGGGGGAACTTGG - Intergenic
1143757105 17:9075183-9075205 CTATAAAATGGGGTTCAGCTGGG + Intronic
1144217152 17:13066585-13066607 CTAAAAAAGGAGTGGGAGCTAGG - Intergenic
1144428090 17:15164154-15164176 CTATAAATCGTGGTGGAGCAGGG + Intergenic
1147614098 17:41818357-41818379 GCAGAAAATGAGGTGGAGGTGGG - Intronic
1148260940 17:46183130-46183152 CTAAAGAATGAGTAGGAGCTGGG + Intronic
1148916423 17:50983781-50983803 CTATAAAATGAGGATGACCATGG + Intronic
1149806273 17:59620333-59620355 ATATTAAATGATGTGGGGCTTGG + Intronic
1150179503 17:63102002-63102024 GTAGAAAATGAGTTAGAGCTGGG + Intronic
1150201815 17:63364953-63364975 ATCTAAAATGAGGTGGAAGTAGG + Intronic
1150702827 17:67462640-67462662 CATGCAAATGAGGTGGAGCTAGG + Intronic
1151093273 17:71466710-71466732 TTAAAAAATGGGGTGGAGCAGGG - Intergenic
1151765983 17:76133257-76133279 ACTTAAAATGAGGTGGGGCTGGG + Intergenic
1153189502 18:2522035-2522057 CTAGACCATGGGGTGGAGCTTGG - Intergenic
1153982989 18:10328448-10328470 ATATAAGATGAGATGGAGCAGGG + Intergenic
1154969626 18:21394258-21394280 CTCCAAATTGATGTGGAGCTAGG - Intronic
1156690437 18:39700684-39700706 CTAGAAAATAGGGTGGAACTAGG + Intergenic
1158798456 18:60876972-60876994 TTATAAAATGAACTGTAGCTAGG + Intergenic
1159112739 18:64078634-64078656 CTATACCATGAGGTGATGCTTGG - Intergenic
1160186902 18:76682833-76682855 CAAAAAAATGGGCTGGAGCTGGG - Intergenic
1161868862 19:6854958-6854980 ATATACAAAGAGGTAGAGCTGGG + Intronic
1161934396 19:7362649-7362671 CTATAAAATGAGTTGGTGAGGGG - Intronic
929035777 2:37690298-37690320 CTATAAAATGAGGTGGACATAGG - Intronic
929502033 2:42498619-42498641 CATTAAAATGAGGTGGAATTTGG + Intronic
932338824 2:70946834-70946856 CTGTAAAATGAGGCCGATCTAGG + Intronic
933999260 2:87692933-87692955 CATTAAAATGAGGTGGAATTTGG + Intergenic
934948964 2:98563334-98563356 CTGGAAGATGAGGTGGAGATGGG + Intronic
936072695 2:109381950-109381972 CATTAAAATGAGGTGGAATTTGG + Intronic
936294589 2:111257958-111257980 CATTAAAATGAGGTGGAATTTGG - Intergenic
937370987 2:121296922-121296944 CCAAGAAATGAGGTTGAGCTTGG + Intergenic
938084072 2:128386717-128386739 CAAAAAAATGAGGTCGTGCTGGG - Intergenic
941543318 2:166814442-166814464 CATTAAAATGAGGTGGATTTGGG - Intergenic
944544885 2:200789285-200789307 CTATAAAATGAGGGAGAGGTGGG + Intergenic
944660857 2:201920430-201920452 ATAAAAAATGAGGTGGGGCGTGG + Intergenic
945250503 2:207761978-207762000 CATTAAAATGAGGTGGTGTTTGG + Intergenic
947450896 2:230207807-230207829 GTAAAGAATGAGTTGGAGCTGGG - Intronic
1169298699 20:4423187-4423209 CTAAAAAAGGAGTTGGAGGTGGG + Intergenic
1170146597 20:13181722-13181744 ATCTAAAAAGAGGTGGAGCTGGG - Intergenic
1173975668 20:47184708-47184730 CTATAAAATGGGGTGTGGCCGGG - Intronic
1175526030 20:59634251-59634273 CTCTGAAATCAGGCGGAGCTGGG + Intronic
1176959020 21:15138884-15138906 CTGTAAAATGAGGTGGTCCCTGG + Intergenic
1177184330 21:17776678-17776700 CTATTATAAGGGGTGGAGCTGGG - Intergenic
1179386035 21:40942658-40942680 CTATAAAGTGAAATGGAGCAAGG - Intergenic
1182193771 22:28492700-28492722 CTAAAAAATGATGAGGAGATAGG + Intronic
1182269029 22:29141846-29141868 CTATGAAATGGGGTGGGGCAAGG - Intronic
1182588334 22:31359730-31359752 CTATCAACTGAGGTGGAGCTTGG + Intergenic
1183169138 22:36172128-36172150 CTGTGGAATGAGGTGCAGCTGGG + Intergenic
1184143337 22:42592782-42592804 CTGTAAAATGAGGTGGAGATCGG - Intronic
949472724 3:4413728-4413750 GTATAAAATCAGGTCTAGCTGGG + Intronic
950428497 3:12937621-12937643 CTATTAAATGGGGTAGTGCTGGG + Intronic
950873787 3:16251740-16251762 CTGTAAAATGGGGTGGCGGTAGG - Intergenic
950968513 3:17163618-17163640 CTATGAAATGAGGTAGGTCTGGG - Intronic
951352979 3:21629290-21629312 CTATAATTTCAGGTGGAGGTTGG + Intronic
951437311 3:22679675-22679697 CAATAAACTGAGGTGGGGCATGG + Intergenic
952286038 3:31970641-31970663 CTTTAAAATGAGATGGAGGTGGG - Intronic
953820092 3:46200622-46200644 CTATAAAGTGAAGAGGAGCCTGG - Intronic
954882156 3:53843818-53843840 CTGTAAAATGGGGTGGTGATAGG - Intronic
955190660 3:56758297-56758319 ATAGAAAATGAGGCGGGGCTTGG + Intronic
955976329 3:64484058-64484080 CTCTAAAATGGGGTGAGGCTGGG - Intergenic
956404465 3:68913371-68913393 GTATACAAGGAGGTGGAACTGGG - Intronic
956497204 3:69840509-69840531 GAATAAAATGTGGTGGAGATTGG + Intronic
957106685 3:75898026-75898048 CTCTAACATGAGGTTGAACTAGG - Intergenic
957664534 3:83208214-83208236 CTAAAAAATGGGGTGCAGATGGG + Intergenic
959370196 3:105514345-105514367 CCATAAAATTAGGTAGAGATGGG + Intronic
959799552 3:110475572-110475594 CAAGAAAATGAAGTGGAGGTAGG - Intergenic
960324036 3:116273189-116273211 GGATAAGATGAGGTGGAGATAGG - Intronic
961288751 3:125828182-125828204 CTATAAAAGGATGTGCAGGTAGG - Intergenic
962535838 3:136328079-136328101 CTGGAAGCTGAGGTGGAGCTGGG - Intronic
964684221 3:159377175-159377197 GTATCAAAGGAGGTGGTGCTTGG - Intronic
964843418 3:161019828-161019850 CTATAAAATGTTGTGCTGCTGGG + Intronic
965078770 3:164011140-164011162 CAATAATATGAGGTCGAGGTGGG + Intergenic
965078807 3:164011650-164011672 CAATAATATGAGGTCGAGGTGGG + Intergenic
965661087 3:171042545-171042567 GTTTAAAATGAGGTGGGGCAGGG - Intergenic
969212086 4:5695889-5695911 TTAAAAAAAGATGTGGAGCTGGG + Intronic
970344346 4:15138794-15138816 CTATAAAATAAGGTAGAACAGGG + Intergenic
971498112 4:27289266-27289288 ATATAAAAGGATGTGGAGCTTGG - Intergenic
971832048 4:31707069-31707091 CTATAAACTGACCTGAAGCTGGG - Intergenic
971916490 4:32876204-32876226 AGATAAAATGAGGTGGTGTTTGG + Intergenic
972307032 4:37840682-37840704 CTCTAAAATCAGATGCAGCTGGG - Intronic
974687260 4:65246117-65246139 CTAAAAAATGAGGTTATGCTTGG + Intergenic
975339927 4:73227447-73227469 CTATAAAATTAGGTTGAGGCTGG - Intronic
975516162 4:75250797-75250819 GTACAAAGTGAGGTGGAGATGGG - Intergenic
976594548 4:86882710-86882732 CATTAAAATAAGGTGGAGTTTGG - Intronic
976847947 4:89511631-89511653 CAATGAAATGAGATGGAGTTGGG + Intergenic
979054038 4:115974181-115974203 ATATAAAATGAGGAAGAGGTGGG + Intergenic
979232450 4:118360907-118360929 TTTTAAAATGAGTTGGGGCTGGG - Intergenic
982174289 4:152690754-152690776 CATTAAAATGAGGTGGAATTTGG + Intronic
983342450 4:166481451-166481473 CATTAAAATGAGGTGGAATTTGG - Intergenic
984222517 4:176995151-176995173 ATAGAAAATGAGGTGGGGCCAGG - Intergenic
984267924 4:177516329-177516351 CTAAAAAATTAGTTGGGGCTGGG + Intergenic
984964073 4:185126142-185126164 CATTAAAATGAGGTGGGGCCAGG + Intergenic
986601319 5:9475910-9475932 CTGTAAAATGAGTTGAAGTTTGG - Intronic
990104137 5:52235598-52235620 TAATAAAATGAGGTTGAGATGGG - Intergenic
991959127 5:72024240-72024262 CTATACAAGGAGGTGGTGGTAGG - Intergenic
992553192 5:77878662-77878684 CTATAGAATTAGGTTGAGATTGG + Intergenic
993314138 5:86377456-86377478 CTATATAATTAGGTGGAACTAGG + Intergenic
993933157 5:93967814-93967836 CTCTTAAATGAGCCGGAGCTGGG - Intronic
994086522 5:95765597-95765619 CTATAAAATGAGGGGTAAATTGG + Intronic
995349649 5:111160222-111160244 CTATAAAATGAGATTTGGCTGGG + Intergenic
996313428 5:122133853-122133875 TTCTAAAATAAGCTGGAGCTGGG - Intronic
997021038 5:130002079-130002101 CTATAAACAAAGGTGGTGCTTGG + Intronic
999408850 5:151332160-151332182 CTTAAAAATGAGATGGAGCCGGG - Intronic
999888651 5:155952451-155952473 CAAGAAAATGAGGAAGAGCTAGG - Intronic
1001115420 5:168935266-168935288 CTCTAAAATGTGGTGAAGTTGGG + Intronic
1005590649 6:27322521-27322543 CTATAAAATAAGGAGCAGCTGGG - Intergenic
1006234461 6:32616427-32616449 CAATAAGAGGAGGTGCAGCTGGG + Intergenic
1006616327 6:35330049-35330071 CATTAAAATGAGGTGGAATTTGG + Intergenic
1006698608 6:35953299-35953321 CTACAAAAAGAGGAGGAGCAAGG + Intronic
1008045420 6:46847210-46847232 TTATAAAGTGAGATGAAGCTGGG + Intergenic
1008552323 6:52644969-52644991 CTATAAAATGTGGTGATGCATGG - Intergenic
1008979108 6:57463194-57463216 CTAGAAAATGAGGCGAGGCTGGG + Intronic
1009167244 6:60356186-60356208 CTAGAAAATGAGGAGAGGCTGGG + Intergenic
1009282304 6:61768454-61768476 CTTTAAAATGAGGTTGAGAAAGG - Intronic
1009567830 6:65335578-65335600 CTTTAAAATGAGGTGGAATTTGG - Intronic
1010863617 6:80944453-80944475 CAGTAAAATGAGTAGGAGCTGGG - Intergenic
1014068753 6:117157065-117157087 GTAGCAAATGTGGTGGAGCTGGG - Intergenic
1014879839 6:126710114-126710136 CTATAAAATCAGGTGAATATAGG + Intergenic
1015041709 6:128728366-128728388 CTACAACATGAGGTGGAAGTGGG - Intergenic
1015647535 6:135410393-135410415 CTATAAAATGAGGTGGTTTTTGG - Intronic
1017070470 6:150571498-150571520 CTATAAAATAGGTTGAAGCTGGG - Intergenic
1017642653 6:156509426-156509448 CAATAAGAGGAGGTGGTGCTGGG - Intergenic
1017800884 6:157895144-157895166 CATTAAAATGAGGTGGAATTGGG + Intronic
1018073542 6:160188817-160188839 ATATAAAATGGTATGGAGCTGGG + Intronic
1018276724 6:162140356-162140378 CTATAAAATGAAGTTGAACATGG - Intronic
1019988002 7:4672209-4672231 CTAGAAAATGAGGTATAGCTGGG - Intergenic
1020158510 7:5748280-5748302 CATTAAAATGAGGTGGAATTTGG - Intronic
1021085771 7:16420329-16420351 CTGAGTAATGAGGTGGAGCTTGG - Intronic
1026140128 7:67698636-67698658 CATTAAAATGAGGTGGAGTTGGG + Intergenic
1026411788 7:70130626-70130648 CAATATAATGAGATGGAGGTGGG + Intronic
1026928956 7:74212567-74212589 CTATAAAATGAGGTCGGGCTGGG - Intronic
1027487520 7:78780593-78780615 GTAGAAAATGAGGTGAAGATCGG - Intronic
1032596071 7:133241806-133241828 ATATAAAATGAGGTCGGGCATGG - Intergenic
1033121033 7:138666726-138666748 CATTAAAATGAGGTGGAATTTGG - Intronic
1033121117 7:138667539-138667561 ATATAAAATGAGGTGAACATTGG - Intronic
1034310850 7:150086372-150086394 CTATAAATGGGGGTGGAGGTGGG + Intergenic
1034398748 7:150847556-150847578 CTATATACAAAGGTGGAGCTAGG - Intronic
1034795996 7:154014262-154014284 CTATAAATGGGGGTGGAGGTGGG - Intronic
1036403079 8:8427757-8427779 CTAGAGAATTAGTTGGAGCTAGG - Intergenic
1036443347 8:8800764-8800786 AGATAAAAGCAGGTGGAGCTGGG - Intronic
1037693378 8:21202874-21202896 CTATAAAAGGGGGTGGGGCGTGG + Intergenic
1038551738 8:28475621-28475643 CTATAAATTGAGTAGGAGTTAGG - Intronic
1038858517 8:31359873-31359895 CAATAAAATGAGGTGGAATTTGG - Intergenic
1039662036 8:39478210-39478232 CACTAAAATGAGGTGGAATTTGG - Intergenic
1041451518 8:58011473-58011495 CATTAAAATGAGGTGGAATTTGG - Intronic
1041934942 8:63323770-63323792 CTTTGGAATGAGGTGGAGTTTGG - Intergenic
1043507554 8:80917324-80917346 CATTAAAATGAGGTGGAATTTGG + Intergenic
1045210824 8:100097853-100097875 GTATTAAATGAGGTGTGGCTAGG - Intronic
1045327486 8:101127508-101127530 GTATAAAATGGGGTGGGGGTGGG + Intergenic
1047142796 8:122160870-122160892 CAATAAAATGAATTGGAACTAGG + Intergenic
1047378763 8:124334468-124334490 TTATAAAATTAGCTGGGGCTGGG + Intronic
1048110489 8:131462522-131462544 CAATAAAGTGTGGTGGAACTGGG + Intergenic
1048960445 8:139572571-139572593 TTATAAGAAGAGGTGGATCTGGG - Intergenic
1052596631 9:30569112-30569134 TTAAAAACTGAGCTGGAGCTAGG - Intergenic
1053652146 9:40179523-40179545 TTATAAAGTGAGATGAAGCTTGG - Intergenic
1053902539 9:42808837-42808859 TTATAAAGTGAGATGAAGCTTGG - Intergenic
1054532438 9:66196683-66196705 TTATAAAGTGAGATGAAGCTTGG + Intergenic
1054854115 9:69879583-69879605 CATTAAAATGAGGTGGAATTTGG + Intronic
1059854058 9:118375736-118375758 CTATAAAATGAGGTCAAGAAAGG + Intergenic
1061844417 9:133378953-133378975 CCAGAAAAGGAGTTGGAGCTGGG + Intronic
1188328035 X:28831261-28831283 CTATAAAATGAGATGGTCATAGG - Intronic
1189552263 X:42105443-42105465 CTATAAACTGAGGTGGAGAGAGG - Intergenic
1189640461 X:43064458-43064480 CTGTAAAATGAAGTAGAGGTAGG + Intergenic
1189811654 X:44786240-44786262 CTTTTAAATGAGGATGAGCTTGG + Intergenic
1192808332 X:74529099-74529121 CTATAAAATGGGGTGGTGGGAGG - Intronic
1195156164 X:102126132-102126154 CGCAAAAATGAGGTGGCGCTGGG + Intronic
1195199956 X:102539246-102539268 CTATCAAATGGCCTGGAGCTGGG + Intergenic
1195464940 X:105169914-105169936 CTATAAATTGAGTTGGTCCTAGG + Intronic
1196652220 X:118179587-118179609 ATATAGAAAGAGATGGAGCTGGG + Intergenic
1196816433 X:119668655-119668677 CTATAAAATGTGGAGGGGCCGGG + Intronic
1198061589 X:133050988-133051010 CTATAAAATAAGGTGACTCTAGG + Intronic
1199554664 X:149093422-149093444 CTATTAAATGAAGTAGAGCAAGG - Intergenic