ID: 1077745958

View in Genome Browser
Species Human (GRCh38)
Location 11:4905920-4905942
Sequence CATTTCCAACAGAAATTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 182}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077745958 Original CRISPR CATTTCCAACAGAAATTGGG TGG Intronic
900276781 1:1835108-1835130 CTTTCCCAACAGCAAATGGGCGG + Intronic
902063457 1:13664737-13664759 CATGCCCTACAGAAATTGGAGGG - Intergenic
903029127 1:20450358-20450380 CTTTTACACCAGGAATTGGGAGG - Intergenic
903828228 1:26160021-26160043 CATTTCTAACGGAAATTGCTTGG + Intronic
906621168 1:47280822-47280844 CATTTCCAGCAGAAACTGTTTGG + Exonic
906988521 1:50712807-50712829 CATAACCAACATAAATTAGGGGG - Intronic
908717561 1:67086724-67086746 GACTTGCAACAGAAATCGGGTGG - Intergenic
909780908 1:79545817-79545839 CATTTCAACCAGAATTTTGGAGG + Intergenic
910607323 1:89100898-89100920 CATTTCCAACAAAAATTAATTGG + Intergenic
912996023 1:114533305-114533327 CAATCCCAACACAATTTGGGAGG + Intergenic
913274732 1:117125915-117125937 CATTACCATCAGACATTGAGTGG + Intergenic
914433518 1:147640738-147640760 CTTTTCCTGAAGAAATTGGGAGG - Intronic
915184686 1:154095043-154095065 CAATTCCAAAAAAAATCGGGAGG + Exonic
915792856 1:158693945-158693967 CATATTCAACAGAAAATGGCAGG - Intergenic
916001460 1:160620327-160620349 CAATTCCCCCAGAAATAGGGAGG - Intronic
916931114 1:169578924-169578946 CCTTTCCAATAGAAAATGTGGGG - Intronic
917665919 1:177225563-177225585 CAGTTCCACCAGAAGTTGTGAGG + Intronic
918332166 1:183471605-183471627 CACTTCCCACAGCAACTGGGGGG - Intergenic
923430265 1:233913143-233913165 CATTCACAACAGAAATAGAGGGG + Intronic
1063099603 10:2937989-2938011 AATTTCCAAAAGACATTGTGAGG - Intergenic
1063734047 10:8732309-8732331 CATATTTAAAAGAAATTGGGTGG - Intergenic
1063854192 10:10228898-10228920 GTTTTCCAACAGAAATGGAGAGG + Intergenic
1064896635 10:20244647-20244669 AATTTCCAAAAGAAAATGAGAGG + Intronic
1068825279 10:61430840-61430862 GATTTACAGCAAAAATTGGGAGG - Intronic
1069880775 10:71591652-71591674 CATATATAGCAGAAATTGGGAGG + Intronic
1070269930 10:74943809-74943831 TTTTTCCAAAAGAAATTGGTAGG + Intronic
1076002383 10:126922613-126922635 CATTTCCACAAGAGATTTGGAGG + Intronic
1077745958 11:4905920-4905942 CATTTCCAACAGAAATTGGGTGG + Intronic
1078050545 11:7961829-7961851 CATTTCAACCTGAAATTTGGAGG - Intronic
1080809670 11:35691094-35691116 CTTTTCCAACAGAAAATGTGGGG + Intronic
1081677227 11:44977440-44977462 CATTTCCAAGAGAATTTTGCAGG - Intergenic
1082798721 11:57397776-57397798 GCCTGCCAACAGAAATTGGGAGG - Intronic
1086968409 11:93054132-93054154 GATTTCCAAAAGAAAATGTGGGG - Intergenic
1088489728 11:110375257-110375279 CTTATCCAACTGAAATTGGATGG + Intergenic
1089600933 11:119614480-119614502 CACTTCCATCAGACAGTGGGTGG - Intergenic
1091139218 11:133220968-133220990 CATTTCCGACAAAAAATGGAAGG - Intronic
1092565081 12:9656576-9656598 CATTTACAAAACAATTTGGGAGG + Intergenic
1093386723 12:18566130-18566152 CATTTCCAACAGTAATCAGTGGG + Intronic
1094169908 12:27480525-27480547 CATTTCAAAATGAGATTGGGTGG - Intronic
1094676194 12:32622460-32622482 TATTTCCAACAAGAATTGGGAGG - Intronic
1097428602 12:59475323-59475345 AATTTCCAACAGCAATTGGGGGG + Intergenic
1100348719 12:93757726-93757748 CTTTTCCTACAGAAATGGAGAGG - Intronic
1102030165 12:109735708-109735730 CACTTCCAAAAAAAACTGGGCGG + Intronic
1102839982 12:116108477-116108499 CATTGTCAACAGAAGTTGGAAGG - Intronic
1108112433 13:47090068-47090090 CAATTCCAACATGAATTTGGAGG + Intergenic
1108846678 13:54686591-54686613 CACCTCCAGCCGAAATTGGGTGG - Intergenic
1110930711 13:81212505-81212527 CATTTCTAACGTAAATTGAGTGG - Intergenic
1111310276 13:86475299-86475321 CAAGTCCAACAAAAATTGAGGGG - Intergenic
1115518955 14:34213697-34213719 AATTTCCTTCAGAAATTGGAAGG + Intronic
1115721773 14:36169679-36169701 CATTTTGTACAGAAACTGGGAGG - Intergenic
1115994018 14:39176720-39176742 AAATACCAACAGAACTTGGGGGG - Intronic
1116430766 14:44842672-44842694 CATTTCTAACCCAACTTGGGAGG - Intergenic
1117379995 14:55152487-55152509 GATTTCCAACGGAAATTCTGGGG + Intronic
1121998673 14:98627717-98627739 CATGTCTAACACAAATTTGGAGG + Intergenic
1122267965 14:100555453-100555475 CACTTCCAACAGAAGGTGGGGGG + Intronic
1122881639 14:104693008-104693030 CATTTCCAACAGACAGAGGTTGG - Intronic
1128221096 15:65969233-65969255 CATTTCCAACAACAAGCGGGCGG + Intronic
1129988854 15:79944106-79944128 CATTACCACCACAAAGTGGGTGG + Intergenic
1131924438 15:97366409-97366431 CATTCCAAAAAGAAATTGAGGGG - Intergenic
1134043623 16:11085900-11085922 CATTTCAACCTGAGATTGGGCGG + Intronic
1134078777 16:11310606-11310628 TATGTCCAACAGAAATGTGGTGG - Intronic
1140741814 16:77948163-77948185 CAATTCCAACAGAGTGTGGGAGG - Intronic
1144247135 17:13378143-13378165 CATTACCTACACACATTGGGAGG + Intergenic
1144450627 17:15375057-15375079 CAGGTCCCACAGAAAGTGGGAGG - Intergenic
1147694689 17:42342516-42342538 CATTTCCTACAGTAATGGTGAGG + Intronic
1156153879 18:34278386-34278408 CATTTAAAAGAGAAATTTGGAGG + Intergenic
1156811689 18:41260570-41260592 CATTGCCAACAGACAATGGTTGG + Intergenic
1158813445 18:61065500-61065522 CTTTTTAAACAGACATTGGGAGG + Intergenic
1159372353 18:67544744-67544766 CATTTCAACAAGAAATTTGGAGG + Intergenic
1162012656 19:7827626-7827648 CTTTTCCAACAGAAATGTGTTGG + Intergenic
925424624 2:3738727-3738749 CATATACAAGATAAATTGGGTGG - Intronic
925940194 2:8809760-8809782 TATTTCTGACAGAAATAGGGAGG - Intronic
927338814 2:21956694-21956716 CATTTGCCACAGACATTGTGTGG - Intergenic
927702778 2:25278312-25278334 CATTTTAAAGAGAACTTGGGTGG - Intronic
927744538 2:25605013-25605035 CATTTTAAACAGAACTTGGCTGG - Intronic
931999514 2:67871783-67871805 CAGTTCCAACAGATTTTGTGGGG + Intergenic
932606931 2:73171718-73171740 CATTTCCAAGGGAAGCTGGGTGG - Intergenic
933925497 2:87088693-87088715 CATTTCCAAGGGAAGCTGGGTGG + Intergenic
937682928 2:124664076-124664098 CATATCCAAGAAAATTTGGGAGG - Intronic
938745382 2:134273115-134273137 CATTTCCCCCAGAAGGTGGGGGG + Intronic
940496763 2:154439286-154439308 AATTTCCAACAGTAATTTTGTGG - Intronic
943464867 2:188217367-188217389 CATTTCTAACAGAAAGCGGCTGG + Intergenic
944622871 2:201535949-201535971 CATCTCCAACAGAAATTAGCTGG - Intronic
948581993 2:238993875-238993897 CATTTCCACCAAGAATTGGTGGG - Intergenic
1169792957 20:9430956-9430978 GATTGCCAACAGTAATTGAGGGG - Intronic
1170895263 20:20407031-20407053 CATTTCCATGTGAAATGGGGAGG + Intronic
1172087398 20:32397651-32397673 CAATTCCAGCAGCATTTGGGAGG - Intronic
1177873802 21:26606720-26606742 AATGTCCAAGAGAGATTGGGAGG - Intergenic
1177959151 21:27640321-27640343 CATTTCCACAGGATATTGGGAGG - Intergenic
1182011338 22:27003218-27003240 CATTTCCAATAAAAAGAGGGAGG - Intergenic
1184612900 22:45616584-45616606 TATACCCAACAGAAACTGGGGGG - Intergenic
950753984 3:15156845-15156867 CATTTCCAAGACAACTTGGAAGG - Intergenic
951697398 3:25460012-25460034 CATTTCCCATGGAATTTGGGTGG + Intronic
952519268 3:34139108-34139130 AATTACTAACAAAAATTGGGAGG - Intergenic
952561942 3:34604934-34604956 CATTTCCATCACAAAATGGATGG - Intergenic
952618639 3:35307681-35307703 CACTTGCAACAGAAATTTAGAGG + Intergenic
953875783 3:46666176-46666198 CATGTCCAAAAGTATTTGGGAGG - Intergenic
954621949 3:52001530-52001552 CATTTCCAGCAGAAACTGGAAGG + Intergenic
955465498 3:59232863-59232885 CACTGCCAACATGAATTGGGAGG - Intergenic
958906662 3:99949081-99949103 AAATTCCAAAAAAAATTGGGAGG + Intronic
959631979 3:108517262-108517284 CATTTTGATCAGAGATTGGGAGG - Intronic
959813664 3:110649971-110649993 CATTTCTAAAAGGAATTTGGAGG + Intergenic
960172608 3:114480036-114480058 CATCTTCAACAAAAATTAGGGGG - Intronic
960392655 3:117097769-117097791 AATTTCCAAAATAATTTGGGAGG - Intronic
960811537 3:121631761-121631783 CATTTGCAGCAGGAATAGGGAGG + Exonic
962306498 3:134291601-134291623 CATTTCCAAAATGAATTGGGAGG - Intergenic
965231774 3:166063307-166063329 CATTTGCAAAAGAAAATGGTAGG - Intergenic
965396035 3:168161351-168161373 CATTTCCAAAAGAAAGTAGAGGG + Intergenic
968171959 3:196517931-196517953 CTTTTCTAACAGAAAGTGGCTGG + Intergenic
968312544 3:197695971-197695993 CATTTCCCACAGAAGGTGGTCGG - Exonic
968970826 4:3792670-3792692 CATTTCCTACTGAAATTGAAGGG - Intergenic
969545469 4:7823793-7823815 CATCTCCAACAGTGCTTGGGAGG + Intronic
970387855 4:15574090-15574112 TTTTTCCAACAGAAGTTGAGAGG - Intronic
970693930 4:18653654-18653676 CATTTCCTACAGAAGCTTGGAGG - Intergenic
972161889 4:36237382-36237404 CATTTCCACATGAAATTTGGAGG - Intronic
972734180 4:41824300-41824322 CATTTCCAACAAAAGGTGGGAGG + Intergenic
973864919 4:55102857-55102879 CACTTCCAAGAGAAATTTGAAGG - Intronic
975460064 4:74641269-74641291 CATTTACAACAGACAATGGCAGG - Intergenic
979523541 4:121695338-121695360 CCTTTCCAAGTGAAAATGGGAGG - Intronic
980652285 4:135733685-135733707 TATTTGCAACAGAGATTGTGTGG - Intergenic
981341696 4:143628849-143628871 CATTTCCAAAAAAGATTGGCAGG + Intronic
981930079 4:150180356-150180378 TATTTCCAACAGAAATGGAATGG - Intronic
982274201 4:153622823-153622845 CATTTCTAACAGAAAGAGAGAGG - Intronic
984154762 4:176181873-176181895 GATTTCAGACAGAAATTGGGTGG - Intronic
986246357 5:6011031-6011053 CATTTCCACATGAAATTTGGAGG - Intergenic
986892225 5:12322516-12322538 AGTTTCCAACAGAAATTTTGAGG + Intergenic
987271215 5:16311174-16311196 CATTTCCAAAACAAACTGTGGGG - Intergenic
993335909 5:86658549-86658571 CATTTCCTTCAGACATTTGGAGG + Intergenic
994874185 5:105393678-105393700 CATTCCCACCAGAAATATGGTGG + Intergenic
995918926 5:117287347-117287369 CATTTTCAAAGGAAATTAGGTGG - Intergenic
997131161 5:131277995-131278017 CATTTCAAAAAAAAAGTGGGGGG - Intronic
997432211 5:133848297-133848319 CATTCCCAAGGGAAACTGGGAGG + Intergenic
998089590 5:139356567-139356589 CATTTTCAACAAAAATTATGAGG - Intronic
999920471 5:156313610-156313632 GATTTCCCACAGACATTCGGAGG - Intronic
1003431674 6:6044097-6044119 CATTTCAAGCAGTAATGGGGGGG - Intergenic
1007319616 6:41018012-41018034 CATTCCACACAGAAAGTGGGTGG + Intergenic
1010471002 6:76228566-76228588 AATATGTAACAGAAATTGGGGGG - Intergenic
1012313572 6:97757607-97757629 CATTTCAAAAAGAAATAGGCAGG + Intergenic
1018254551 6:161904946-161904968 AATGTCAATCAGAAATTGGGAGG - Intronic
1020931265 7:14398479-14398501 CATTTTCAAAAGAAATAGCGAGG + Intronic
1021964836 7:25907128-25907150 CTTTACCATCAGGAATTGGGAGG + Intergenic
1023343941 7:39252031-39252053 CATTTCAGATAGAAATTGGGCGG - Intronic
1023482825 7:40652999-40653021 CATTTTCAAGACAAACTGGGAGG - Intronic
1024440981 7:49417100-49417122 CATTTCCACAAGAGATTTGGAGG + Intergenic
1025593890 7:62900478-62900500 CATTTCCAACTGAGATTGGAAGG + Intergenic
1025728467 7:64089094-64089116 CATCTCCAGCAGAAGTTGAGTGG + Intronic
1026219712 7:68383137-68383159 CATTTCAAACAGTAATTTGGAGG - Intergenic
1029424467 7:100487301-100487323 CATTCTCAAAAGGAATTGGGGGG + Intronic
1029986650 7:104928917-104928939 CATTTATAAAAGAAGTTGGGGGG - Intergenic
1030149213 7:106386130-106386152 CATTTCCACAAGAAATTAAGAGG + Intergenic
1030796216 7:113791130-113791152 AATTTACAACTGAAATTGGAAGG + Intergenic
1033594354 7:142845575-142845597 CATTTCCAAATGAGATTTGGAGG - Intergenic
1037929453 8:22869200-22869222 CATTTACAACATAAATAGGATGG - Intronic
1038088468 8:24227027-24227049 GATTTCAAACAGGAATTGAGTGG + Intergenic
1038321029 8:26527601-26527623 CATTTCAAAAATGAATTGGGGGG + Intronic
1038533438 8:28337208-28337230 CATTCCAAACAGAAAGTTGGAGG + Intronic
1038738323 8:30192680-30192702 AATTTCAAACATAAATTTGGGGG + Intergenic
1039870803 8:41543663-41543685 CATTTCCAAGAGAAATCAGTAGG + Exonic
1042752129 8:72169956-72169978 CATTTCCAGAAGAATTTAGGGGG + Intergenic
1043559966 8:81481056-81481078 AATTTTCAACAGAATTTTGGGGG + Intronic
1045071597 8:98511667-98511689 CATTTCCAGGAGAAAGTGGATGG - Intronic
1045543230 8:103105817-103105839 TATTTTTAACCGAAATTGGGTGG - Intergenic
1045688805 8:104739152-104739174 GATTTCAAACAGAACTTTGGAGG + Intronic
1046571150 8:115967767-115967789 CATGTCCTAAAGAAAATGGGTGG + Intergenic
1046937417 8:119898162-119898184 TAGTTGCAACAGAAATTGTGTGG + Intronic
1047688093 8:127321730-127321752 CATTTCCAAAAGATATTTAGAGG - Intergenic
1048199743 8:132362445-132362467 CAGTTCCAGCAGAAACTGAGAGG + Intronic
1048560299 8:135528926-135528948 CATTTTCAACATGAATTGGAGGG + Intronic
1048870841 8:138796526-138796548 CATTTCCAACAGAATATGCCTGG + Intronic
1049467303 8:142757473-142757495 TATTGCCAACATAAATTGGGAGG - Intergenic
1052262506 9:26534042-26534064 AATTTCCAAATGAAATTTGGGGG - Intergenic
1052753507 9:32516480-32516502 CACTTCCAGCCAAAATTGGGTGG - Intronic
1052885718 9:33646521-33646543 CATTTCTAACAGAAGTTTGTAGG - Intergenic
1054975585 9:71140389-71140411 CATTTCCAAAAGACATAGTGTGG + Intronic
1056205483 9:84315691-84315713 GATTTCCAACAGAATTAGTGGGG + Intronic
1057298430 9:93862522-93862544 CAGTGCCAACAGAAAGTGAGAGG + Intergenic
1057980745 9:99660207-99660229 CAGTGCTAATAGAAATTGGGGGG - Intergenic
1058617988 9:106855285-106855307 CATTTCCTACAGAATTTGATAGG + Intergenic
1058795701 9:108496340-108496362 TATTTGAAACAGAAAATGGGAGG + Intergenic
1059530886 9:115034399-115034421 CATGATCAACAGACATTGGGTGG + Intronic
1061659528 9:132119698-132119720 CATTTCCACCAGCAAGTGGTAGG - Intergenic
1188310488 X:28611141-28611163 CATTTTCAACAAAGATTTGGTGG - Intronic
1189463799 X:41263086-41263108 CATTTCCACGTGAAATTTGGAGG - Intergenic
1189892585 X:45620683-45620705 CATTTCTTACAGAAATGGGTAGG + Intergenic
1189941300 X:46124937-46124959 AATTTGCAACAAAAATTTGGGGG - Intergenic
1190167667 X:48086512-48086534 CATTTTTAACAGCTATTGGGAGG - Intergenic
1192912929 X:75624343-75624365 CATTTCAAATAAAGATTGGGTGG + Intergenic
1195174606 X:102303512-102303534 CATGTCCAAAATAAATTTGGTGG - Intergenic
1195184259 X:102383581-102383603 CATGTCCAAAATAAATTTGGTGG + Intronic
1195197981 X:102517509-102517531 CTCTTCCAACAGACACTGGGTGG - Intergenic
1195346421 X:103954604-103954626 CATCTCCAACAGTAATCGGCAGG - Intronic
1195346985 X:103960783-103960805 CTCTTCCAACAGACACTGGGTGG + Intronic
1195360457 X:104078058-104078080 CTCTTCCAACAGACACTGGGTGG - Intergenic
1195361031 X:104084239-104084261 CATCTCCAACAGTAATCGGCAGG + Intergenic
1195646747 X:107239549-107239571 CATTTCAAACTGGATTTGGGAGG + Intronic
1197261863 X:124328367-124328389 CATTTCAAAAAGAGATTGTGGGG + Intronic