ID: 1077747448

View in Genome Browser
Species Human (GRCh38)
Location 11:4923180-4923202
Sequence CCTCAACTGCAGAATGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 4, 3: 43, 4: 265}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077747448_1077747452 14 Left 1077747448 11:4923180-4923202 CCTTGCTCATTCTGCAGTTGAGG 0: 1
1: 0
2: 4
3: 43
4: 265
Right 1077747452 11:4923217-4923239 AGAGGTAAGTAACTTTCTCCTGG 0: 1
1: 0
2: 9
3: 35
4: 351
1077747448_1077747451 -4 Left 1077747448 11:4923180-4923202 CCTTGCTCATTCTGCAGTTGAGG 0: 1
1: 0
2: 4
3: 43
4: 265
Right 1077747451 11:4923199-4923221 GAGGAAACTGGAGAACAGAGAGG 0: 1
1: 6
2: 99
3: 844
4: 3599

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077747448 Original CRISPR CCTCAACTGCAGAATGAGCA AGG (reversed) Intronic
901272599 1:7964284-7964306 CTTCAACTGTAAAATGAGGATGG - Intronic
902708355 1:18221965-18221987 CCTCATCTGTAAAATGAGAAGGG - Intronic
903972770 1:27129878-27129900 CCTCAGCTGTAGAATGAGGAGGG - Intronic
904377061 1:30088316-30088338 CCTGGCCTGCAGAAGGAGCAGGG - Intergenic
904534635 1:31190958-31190980 CCTCAGCTGCACCATGAGCCTGG - Intronic
904792535 1:33034588-33034610 CATGAAATGCTGAATGAGCAAGG + Intronic
905003309 1:34690539-34690561 CACAAGCTGCAGAATGAGCAAGG + Intergenic
905401743 1:37708681-37708703 CCTCAACTGCAGGCAGGGCAGGG - Exonic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
906066458 1:42984630-42984652 TCTCACCTGCAGAATGGGGAGGG - Intergenic
906688701 1:47778782-47778804 CCTCATCTGCAAAGTGAGAATGG + Intronic
906799362 1:48722461-48722483 CAACAACTGCATAATGAGTAGGG + Intronic
907738554 1:57140327-57140349 CCTCATCTGTAGAATGAGGGAGG - Intronic
908656760 1:66396268-66396290 TCTCAGCTGGAGAATTAGCAAGG - Intergenic
908857875 1:68449936-68449958 CACCAACTGCAGAATGAAGAAGG + Exonic
909635876 1:77816847-77816869 CCTCAAATGTAGAATAAGAATGG + Intronic
910037485 1:82805383-82805405 CCTCAACTGCAGCCTAAGCATGG + Intergenic
913194347 1:116443199-116443221 CCTCTACTGCAGTATGCTCAAGG + Intergenic
916314116 1:163428436-163428458 TCTCAACTGGAGAAGGAGGAGGG + Intergenic
918286147 1:183056657-183056679 CCTCACCTGTATAATGAGCGTGG - Intronic
920177403 1:204111270-204111292 CCTCATCTGTAAAATGAGCATGG - Intronic
920362037 1:205425575-205425597 CCTCATCTGCAGCCTTAGCAGGG - Intronic
920985192 1:210882309-210882331 CCTCAAATGGAGATTGAGCAAGG + Intronic
923558728 1:235022172-235022194 TGTCTCCTGCAGAATGAGCACGG + Intergenic
924219883 1:241863221-241863243 CCTCATCTGTAAAATGAGAATGG - Intronic
1062995127 10:1858465-1858487 TCTCACCTGCAAAATGAGTAGGG - Intergenic
1063457088 10:6191489-6191511 CCTCAAGTTCAGAATGATCTCGG - Intronic
1063946397 10:11180399-11180421 CCTCATCTGCAGGATGAACAGGG + Intronic
1065865214 10:29909124-29909146 CCTCCTGTGCAAAATGAGCAAGG + Intergenic
1065963403 10:30752399-30752421 TTTCATCTGCAGAATGACCAAGG - Intergenic
1067948163 10:50704288-50704310 CCTCAACTGCAAAGTGGCCATGG + Intergenic
1069797346 10:71061867-71061889 CCGGAGCTGCAGAAAGAGCAGGG - Intergenic
1069917803 10:71798082-71798104 CCTAAACTGCTCAATGAGAAAGG - Intronic
1070678539 10:78432974-78432996 CCTCAGCTGTAGAATGAGTCAGG - Intergenic
1070883475 10:79869286-79869308 CCTCAACTGCAAAGTGGCCATGG + Intergenic
1070952377 10:80441681-80441703 CTACAACTGCAGAATAACCAGGG - Intergenic
1071792201 10:88966699-88966721 CCTCATCTGCAAAATGACAATGG + Intronic
1072352267 10:94568247-94568269 GCTCAACTGCATAATGTGTAAGG - Intronic
1073008134 10:100340085-100340107 CCTCAACTGCAGGCTTAGGAAGG + Intergenic
1075842102 10:125513744-125513766 CCACAGCTGCAGAAAGAGCCAGG + Intergenic
1075925441 10:126248128-126248150 CCTCATCTGCAGATTGAGTGTGG + Intronic
1076482417 10:130793187-130793209 CCTGCACTGCAGACTGTGCAGGG - Intergenic
1076490636 10:130859117-130859139 CCTCCAATGCACAATTAGCAAGG - Intergenic
1076505244 10:130968367-130968389 CCTTCAATTCAGAATGAGCAAGG - Intergenic
1077747448 11:4923180-4923202 CCTCAACTGCAGAATGAGCAAGG - Intronic
1078353714 11:10617330-10617352 CCACAAATACAGAAGGAGCAAGG + Intronic
1078402983 11:11044499-11044521 CCTCAACTGTAAAATGAGGATGG + Intergenic
1079318132 11:19427220-19427242 CCTCCCCTGCAGAAAGAGGATGG + Intronic
1080752587 11:35164693-35164715 TCTCCTCTGCAGAGTGAGCAAGG + Intronic
1084430240 11:69106852-69106874 CCTCACCTGCTGAGTGACCAGGG + Intergenic
1085039896 11:73320774-73320796 CCTCAACTTCCCAATGAGCTGGG + Intronic
1085620335 11:78033036-78033058 CCTCATCTGCAAAATGAGGAGGG + Intronic
1086165721 11:83775449-83775471 CCTCATCTGTAAAATGAGTAAGG + Intronic
1088846294 11:113671085-113671107 CCTCAACAGTAGAATCAACAGGG + Intergenic
1089130317 11:116207218-116207240 CCTCCACTGCAGAACGAGCATGG + Intergenic
1089315853 11:117590789-117590811 CCTCAAATGCAGACTGAGAATGG + Intronic
1089342505 11:117768016-117768038 CCTCACCTGTAAAATGGGCAAGG + Intronic
1089637437 11:119824410-119824432 CCTCATCTGTAAAATGAGAATGG - Intergenic
1089810354 11:121126336-121126358 CCTCATCTGCAGCAGCAGCAGGG - Intronic
1090931757 11:131304003-131304025 ACTCAAGTGCAGAATCAGCTGGG - Intergenic
1091271171 11:134312926-134312948 CCTCAAATGCAGACGGAGCCTGG + Intronic
1091741530 12:2963336-2963358 CCTCAACTGCAGGAAAGGCAAGG - Intronic
1092364962 12:7870252-7870274 CCCCATCTGCAAAATGAGCAAGG + Intronic
1094567902 12:31616617-31616639 CCTCACCTGCAAAATGAGAATGG + Intergenic
1095422484 12:42039731-42039753 CCTACACCCCAGAATGAGCAAGG + Intergenic
1096290262 12:50336282-50336304 CCTCTTCTGTAGAATGAGGATGG - Intronic
1096766509 12:53895137-53895159 CCACAGCTTCAGAATGAGCCTGG + Intergenic
1098068928 12:66650928-66650950 CTTCATCTCCAAAATGAGCATGG + Intronic
1098613048 12:72485580-72485602 CCTCACCTGTAGAATGGGGAGGG - Intronic
1098617893 12:72552931-72552953 CCTCACCTTCTCAATGAGCAAGG - Intronic
1099583381 12:84482919-84482941 CCTCAACTAGAGAATAAACAAGG - Intergenic
1101849570 12:108391354-108391376 CCTCAACTATAAAATGAGAATGG + Intergenic
1102958079 12:117072422-117072444 CCTCATCTGGAAAGTGAGCATGG - Intronic
1104769139 12:131349842-131349864 GCTCAACTGCAGAAGCATCAGGG + Intergenic
1106723870 13:32464498-32464520 CCTCAACAGCACAATAATCATGG + Intronic
1106895741 13:34300426-34300448 CCTCAAAGGCAGAAAGAGAAAGG + Intergenic
1109572176 13:64207031-64207053 GGACAACTGCAGAGTGAGCAAGG + Intergenic
1111769410 13:92578108-92578130 CCTCTACTGCAAAAGGAGCTAGG - Intronic
1112030364 13:95451002-95451024 CCTCACCTGCAAAACGGGCATGG - Intronic
1114187950 14:20417406-20417428 CCTCAGCTCCAGAAGTAGCAAGG - Intergenic
1115301622 14:31892100-31892122 TCTAAACTTCAGAATGAGGAGGG + Intergenic
1118316113 14:64727136-64727158 CCTCACCTGTAAAATGAGGATGG - Intronic
1120674614 14:87406452-87406474 CCTCACCTGTAAAGTGAGCACGG + Intergenic
1120756365 14:88248134-88248156 TCTCAAGTGCAGAGAGAGCAAGG - Intronic
1121398991 14:93655189-93655211 CATCAACTGCTGAAACAGCACGG - Intronic
1121545922 14:94763630-94763652 CCTCACCTGCAAAATGGGCTTGG - Intergenic
1121563049 14:94888227-94888249 CCTGACCTGTACAATGAGCATGG + Intergenic
1122242094 14:100375881-100375903 CCTCATCTGTGGAATGGGCATGG + Intronic
1122598336 14:102908537-102908559 CCTCAGCTGCAGAGAGACCATGG - Exonic
1128390684 15:67180589-67180611 CATCATCTGCAGACTGAGCCTGG - Intronic
1129052765 15:72796742-72796764 CCCCATCTGCAGAATGGGGATGG + Intergenic
1130741740 15:86608179-86608201 CCTGAACTGCAGGATGAGAAAGG - Intronic
1130819547 15:87479919-87479941 GCTCAGCTACAGAAGGAGCAGGG - Intergenic
1131515918 15:93076710-93076732 CTTCATCTGCAAAATGAGGATGG - Intronic
1131737574 15:95350144-95350166 CCTCATCTGGAAAATGAGGAGGG + Intergenic
1132329856 15:101004735-101004757 CCTGAACTGCAGAAGGAGCAGGG - Intronic
1132564180 16:613189-613211 CCTCACCTGTAGAATCAGCAGGG + Intronic
1133463981 16:6012202-6012224 CCTCATCTGTAGAATGAGGATGG + Intergenic
1133777186 16:8905980-8906002 CCTCATCTGCCAAATGAGTATGG + Intronic
1134095600 16:11416446-11416468 CCTCATCTGCAGAATGGGAATGG + Intronic
1134250895 16:12573032-12573054 CTACAACTGCAGAATTAGCACGG - Exonic
1136062522 16:27736517-27736539 CCTGAACAGAAGAAGGAGCAAGG + Intronic
1136369355 16:29826251-29826273 CCTCATCTACAAAATGAGAATGG - Intronic
1136500524 16:30667779-30667801 CCTCATCTGTAAAATGAGTAGGG + Intronic
1136858061 16:33677222-33677244 CCTCCACTCCAAAATGAACATGG - Intergenic
1137736513 16:50728139-50728161 CTTCAAATGCTGAATGACCATGG + Intronic
1138121679 16:54405364-54405386 CCTCATCTGTAGAATGGGAAGGG + Intergenic
1140989953 16:80201144-80201166 CCTCAACTGCAAAATGGGAATGG - Intergenic
1141114849 16:81299698-81299720 TCTCCACTGCAGAAAGAGCCTGG - Intergenic
1141980350 16:87546447-87546469 CCTCACCTTGAGAGTGAGCAGGG - Intergenic
1144889811 17:18488160-18488182 TGTCATCTGTAGAATGAGCATGG + Intronic
1145000659 17:19302290-19302312 TCTCATCTGCAGAATGGGGACGG - Intronic
1145142403 17:20456157-20456179 CGTCATCTGTAGAATGAGCATGG - Intronic
1145249315 17:21288681-21288703 CCTCATCTGCAGACTGAGAATGG + Intronic
1146091893 17:29887557-29887579 CCTCATCTGTAAAATGAGGATGG + Intronic
1146289393 17:31597012-31597034 CTTCCACTGCAGAATGGTCAAGG + Intergenic
1148716745 17:49721281-49721303 CCTCAACTGGAAAATGCTCAGGG + Intronic
1149377037 17:56054619-56054641 ACTTAATTGCAGACTGAGCATGG + Intergenic
1151936814 17:77266938-77266960 CCTCACCAGCAGCCTGAGCAGGG - Intergenic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1152877257 17:82793933-82793955 CCTCATCTGCAGAGTCGGCATGG + Intronic
1154049026 18:10935771-10935793 TCTCATCTGCAGCATGACCACGG + Intronic
1154486301 18:14874054-14874076 CCTCACCTGTAGAATGGGAATGG + Intergenic
1155714104 18:28918521-28918543 CCTGAACTTCAGAATGAGAACGG - Intergenic
1155766143 18:29635423-29635445 GCTAAACTGCAAAAGGAGCAGGG - Intergenic
1156384703 18:36594584-36594606 CCTCATCTGCACAATGGGGATGG + Intronic
1156857118 18:41794736-41794758 CCCCAACTCCAGAATAAGCCTGG + Intergenic
1157514371 18:48300460-48300482 CCTCAGCTGCAAAATGAGGGTGG - Intronic
1158219819 18:55139109-55139131 TCTCAACTGTAAAATGGGCATGG + Intergenic
1159095155 18:63893861-63893883 CCTCATCTGTAAAATGAGTACGG - Intronic
1159204890 18:65236620-65236642 GCTAAACTGCAGAAAGAGCATGG + Intergenic
1161420385 19:4173325-4173347 CCTCGCCCGCAAAATGAGCAGGG - Intergenic
1161475515 19:4482771-4482793 CCTCATCTGCAGAATCAGGCTGG + Intronic
1164709204 19:30343447-30343469 CCTCAACTGGAGATGGAGCAGGG - Intronic
1165427856 19:35755673-35755695 CCTCCCCTCCAGGATGAGCACGG - Exonic
1166063906 19:40345391-40345413 CCTCAACTGCACAATAAGAATGG + Intronic
1166816672 19:45550512-45550534 CCCCAGCTGCAGAGTGAGGAGGG - Intronic
1167794985 19:51703211-51703233 CCTGAACTGAAGACGGAGCAGGG - Intergenic
1168297145 19:55383018-55383040 CCTCCACTGCAGAATGGGGATGG + Intronic
1168467795 19:56618283-56618305 CCTCATCAGCAAAATGAGGATGG + Intronic
925295677 2:2775009-2775031 CCTCAGCTGTAAAATGAGGATGG - Intergenic
925712051 2:6750609-6750631 CCTTATCTGCAGAATAGGCAAGG - Intergenic
930678603 2:54231482-54231504 CCTGAGATGAAGAATGAGCACGG + Intronic
930884907 2:56314391-56314413 CCTCATCTGTGGAATGAGAAGGG + Intronic
931222877 2:60304167-60304189 TCTTAATTGCAGAATGAGCCGGG - Intergenic
932266385 2:70370753-70370775 CCTCATCTGTAGAGTGAGGATGG + Intergenic
933287177 2:80397348-80397370 CCTCATCTGTAAAATGAGCATGG - Intronic
933536260 2:83578649-83578671 CCACATCTGAAGAATGGGCAAGG + Intergenic
935129404 2:100250071-100250093 CCCCATCTGCAAAATGAGGAGGG + Intergenic
936645993 2:114373717-114373739 CCTCCACAGCATAATGATCATGG + Intergenic
937278820 2:120703591-120703613 ACTCAGCTGCAGAGTGAGGAAGG - Intergenic
937325385 2:120987022-120987044 ACTCTACTGCAGAACGAGCCAGG + Intronic
937342369 2:121099448-121099470 CCTCACCTGCAGACGGAACAGGG - Intergenic
937552699 2:123113860-123113882 CCTCACCTCCAGACTGAGCAGGG + Intergenic
939620493 2:144413025-144413047 CCTCATCTGTAAAATGAGCCAGG + Intronic
941085697 2:161115052-161115074 CCTCAACTGGAAAGAGAGCAAGG + Intergenic
944736496 2:202571661-202571683 CCTGTACTGTAAAATGAGCATGG + Intergenic
944991588 2:205243481-205243503 TCTCATCTGTAGAATGAGAATGG + Intronic
946201389 2:218072762-218072784 CTTCAACTGCAGAGTGCACAGGG - Exonic
947450214 2:230201039-230201061 ACTCAACTTCAGAGTGTGCAAGG - Intronic
948699309 2:239750420-239750442 TCACACCTGCAGAACGAGCATGG + Intergenic
1168826588 20:818447-818469 CCTCATCTGTAGAATGAGTGAGG + Intergenic
1168851440 20:979750-979772 CCCCAAATGCAGAAGGAGCTGGG - Intronic
1169294857 20:4386286-4386308 GCTCAACAGCAGAATGAAGAGGG + Intergenic
1169526176 20:6428194-6428216 CTTCAAATGCCGAATGACCACGG + Intergenic
1171168932 20:22998211-22998233 TGCTAACTGCAGAATGAGCATGG - Intergenic
1171213337 20:23333983-23334005 CATCACCTGCAAAATGATCAAGG + Intergenic
1172557129 20:35852074-35852096 CCTCATCTGCAAAATAAGAATGG - Intronic
1172578490 20:36028281-36028303 CCGCAAATGCTGACTGAGCAGGG - Intronic
1173058231 20:39636659-39636681 TGTCATCTGCAGAATGAGAATGG - Intergenic
1175259423 20:57665213-57665235 CTTCATCTGCAAAATGGGCATGG - Intronic
1177244538 21:18505864-18505886 CCTCAACTGAAAAATGAATAAGG - Intergenic
1177650106 21:23949362-23949384 TCTCATCTGCAGAATGGGCATGG + Intergenic
1178194663 21:30330197-30330219 GCTCAACTGCAGAATAAGTAAGG + Intergenic
1182055003 22:27345644-27345666 CCTCAACTGGAGAAGGAAGAGGG - Intergenic
1182068722 22:27448266-27448288 CCTCATCTGCAGACTGAGCAGGG + Intergenic
1182088823 22:27580265-27580287 CCTCATCTGCAAGCTGAGCAGGG - Intergenic
1182823786 22:33244373-33244395 CCTCATCTGCACAATGGGGATGG - Intronic
1183145057 22:35982569-35982591 CAAGAACTGCAGAATGAACAGGG + Intronic
1183872810 22:40753355-40753377 GCTCAGCTGCAGGCTGAGCACGG - Intergenic
1184032391 22:41902736-41902758 TCTCACCTGCAGAATGGGGAGGG + Intronic
1184094463 22:42309128-42309150 CCTCATTTGCAGAGTGGGCATGG - Intronic
1185196125 22:49470591-49470613 CCCCAACTGCGGAAGGAGGACGG + Intronic
950154651 3:10712528-10712550 CCTCAACTGCAAAATGGGGATGG - Intergenic
950230528 3:11272082-11272104 CCTCTCCTGGAGAATGACCATGG + Intergenic
952684163 3:36130513-36130535 CCTCAAATTCAAAATGAGAAAGG + Intergenic
954391785 3:50271344-50271366 CCTCCCCTGCAGACAGAGCAAGG - Exonic
954914671 3:54138718-54138740 CCCCAAATGCAGAATGAGGATGG - Intronic
955842573 3:63128012-63128034 CCTCATCTGTGAAATGAGCATGG - Intergenic
956718540 3:72098983-72099005 CCTCAACTACAGAGACAGCATGG - Intergenic
956974009 3:74559213-74559235 TCTCAACAGCAAAATGAGGAAGG + Intergenic
957034967 3:75285557-75285579 CTGTAAATGCAGAATGAGCAGGG + Intergenic
959572589 3:107900671-107900693 CCTGAACATGAGAATGAGCATGG + Intergenic
960376744 3:116911760-116911782 CTTCAACTGGAAAATGAGAAAGG + Intronic
961078855 3:124007143-124007165 CTGTAAATGCAGAATGAGCAGGG + Intergenic
961304623 3:125949298-125949320 CTGTAAATGCAGAATGAGCAGGG - Intergenic
962337651 3:134550803-134550825 CCTTAAATGGAGAATAAGCAGGG + Intronic
965696003 3:171408811-171408833 CCTCAACTGCAAACTGACAAAGG + Intronic
966074260 3:175918354-175918376 ACTTAACTGGAGAATGATCAAGG - Intergenic
968846120 4:3042439-3042461 CCTCAGCTGCAGAATGAAGATGG + Intergenic
969319342 4:6402422-6402444 TCTCACCTGCAAAATGGGCATGG + Intronic
969891636 4:10265192-10265214 ACACATCTGCAGAAAGAGCAAGG - Intergenic
970265024 4:14273055-14273077 CCTCAACTGTGGAATGAGTGTGG - Intergenic
974084425 4:57244332-57244354 CCTCATCTACAGAAAGAGAAGGG - Intergenic
974697982 4:65398893-65398915 GGACAACTGTAGAATGAGCAAGG - Intronic
978634800 4:110791554-110791576 CATCATCTGCACAATGAGCAGGG + Intergenic
980538038 4:134154707-134154729 ACTTAAATTCAGAATGAGCAAGG - Intergenic
981317387 4:143352673-143352695 CATCTACTTCAGAATCAGCAGGG - Intronic
984181291 4:176485715-176485737 CCTAAACTACATATTGAGCAAGG - Intergenic
984408803 4:179369541-179369563 CCTCAACTGCAAAAGGACGAGGG - Intergenic
986234355 5:5893513-5893535 CCTCACCTGGAGAATGGGCGTGG - Intergenic
986321496 5:6635523-6635545 CCCCACCTGTAGAATGGGCATGG + Intronic
986822776 5:11486131-11486153 CCTCCATTTCAGAATGACCAGGG + Intronic
987284436 5:16441570-16441592 CCCCAACTGCAGAAGGGGTAGGG + Intergenic
989661426 5:43802486-43802508 ACTAACCTGCAGAATGAGGAAGG + Intergenic
995045266 5:107639448-107639470 CCTTAACTGCAAAATGAAGATGG + Intronic
995307263 5:110667689-110667711 CCTCACCTGTAAAATGAGAATGG + Intronic
996685979 5:126281224-126281246 ACCCAACTGCAGAATGACAAAGG + Intergenic
996824442 5:127665403-127665425 CCTCATCTGTAAAATGGGCATGG + Intergenic
997360797 5:133293528-133293550 CCTCAACTACAGGAAGAGCTGGG - Intronic
997398370 5:133582344-133582366 CCTCATCTGCAAAATGAGGTAGG + Intronic
997531578 5:134584725-134584747 CCTCAACTGTGGAATCAGCATGG + Intergenic
998157207 5:139793865-139793887 CCTCATCTGCCCAATGAGGATGG - Intergenic
999052051 5:148533518-148533540 CCTTAATTGCAGAAGGAGCACGG - Intronic
999563447 5:152830571-152830593 CCTCAACTGCAGAATGGTGATGG - Intergenic
1001037387 5:168307164-168307186 CCTCATCTGCAGAATGGAGATGG - Intronic
1001455376 5:171856023-171856045 CCTCAGCGTCAGAAGGAGCAAGG + Intergenic
1002810431 6:623021-623043 CCTCATCCTCAGAAGGAGCAGGG + Intronic
1004164054 6:13240186-13240208 ACTCAACTGCAGACTAAGCAGGG + Intronic
1004326262 6:14676471-14676493 CCTCACCTGTAAAATGAGAAGGG + Intergenic
1004955776 6:20726166-20726188 CCTCATCTGCAGAATAACCTTGG + Intronic
1004968047 6:20877253-20877275 CCTCAACTGTTAAATAAGCATGG + Intronic
1006627306 6:35406438-35406460 CCTCAGCTGTAGATGGAGCAAGG + Intronic
1006663787 6:35673916-35673938 CCACAGCTACCGAATGAGCAGGG - Intronic
1007270630 6:40634213-40634235 CCTCATCTGAATAATGAACATGG + Intergenic
1007355068 6:41308818-41308840 CCTCAAGTCTAGAATGACCAAGG + Intergenic
1007362437 6:41368628-41368650 GCTCAAATGGAGAATGAGAAAGG + Intergenic
1008433213 6:51445269-51445291 TCTTAACTGCAGACTGAGAACGG - Intergenic
1008471970 6:51894395-51894417 CCTCAGCTGCAGGCTGGGCAGGG + Intronic
1011610397 6:89145785-89145807 CCACAGCAGCAGAATGAGAACGG - Intergenic
1014779401 6:125546312-125546334 CCAGAATTGCAGAATAAGCAAGG - Intergenic
1015137515 6:129890562-129890584 CTCCAAATGCAGAGTGAGCAGGG + Intergenic
1015531758 6:134227687-134227709 CCTCAACTGTAAAATGGGGATGG - Intronic
1015576822 6:134680591-134680613 TCTCATCTGTAGAATGGGCAAGG - Intergenic
1017102113 6:150857991-150858013 CCCCAAATGCAGAAGGAGCCTGG - Intergenic
1017224097 6:152000175-152000197 CTTCATCTGCAAAATGAGAATGG - Intronic
1018838571 6:167503031-167503053 CCTCACCTACAAAATGAGGATGG + Intergenic
1019187022 6:170226707-170226729 CCTCGACTGCGGAATCTGCAGGG + Intergenic
1019567459 7:1691515-1691537 CCTCATCTGTAAAATGGGCAGGG + Intronic
1019609961 7:1931325-1931347 CCTCATCTGGAGAATGGGGAGGG + Intronic
1019684652 7:2374428-2374450 CCTCATGGGCAGCATGAGCACGG + Intronic
1024194508 7:47045842-47045864 CCTCACTTGCAAAATGAGGATGG + Intergenic
1024242247 7:47444640-47444662 CCTCAGCTGCAGAGTGAGAAGGG + Intronic
1024701557 7:51909178-51909200 CCACAGCTGCATAATCAGCATGG + Intergenic
1024794148 7:53002942-53002964 ACTCAACTGCTGCCTGAGCAGGG - Intergenic
1024976566 7:55119039-55119061 CTTGAACTGTAAAATGAGCAGGG - Intronic
1025550280 7:62238204-62238226 CCTAAACTGCTGAGTGAGAATGG - Intergenic
1026854255 7:73742778-73742800 CCTCATCAGCAGAATAAGGACGG - Intergenic
1027844617 7:83356833-83356855 CCTCAAATGCAGAAAGAAGAAGG + Intergenic
1028155927 7:87429308-87429330 CCTCACTTGCTAAATGAGCAGGG - Intronic
1030063612 7:105642330-105642352 ACTCAACTGCAGAATTAACCTGG + Intronic
1030353991 7:108523063-108523085 CATCAACTGAAAAAAGAGCAAGG + Intronic
1032996806 7:137455842-137455864 CCTCAACTCCACACTGAACATGG + Intronic
1033444618 7:141409452-141409474 CCTCATCTGTATAATGAGGATGG + Intronic
1034544802 7:151782717-151782739 CCTCATCTGTAAAATGAGGATGG + Intronic
1034678689 7:152911408-152911430 CCTGAACTTCAGAAAGAGCCAGG + Intergenic
1034717950 7:153261083-153261105 CCTCAGCAGCAGAATGGGCCAGG - Intergenic
1036656390 8:10679915-10679937 CCTCAGCTGGAGAGTGAGGAAGG + Intronic
1037195652 8:16186258-16186280 TCTCAACAGCAGAGTGAGCCAGG + Intronic
1037719171 8:21428298-21428320 ACTCAACTCCAAAATGTGCAAGG - Intergenic
1039631654 8:39119115-39119137 CATCAACTGGAGAATGAGAATGG - Intronic
1040814089 8:51488597-51488619 CCTAAATTCCAGAATGAGGAAGG - Intronic
1044019573 8:87087833-87087855 CCTCATCTGTAAAATGAGAAAGG - Intronic
1044112851 8:88297774-88297796 CCTCATCTGTAAAATGAGTATGG + Intronic
1044391759 8:91660669-91660691 CCTCATCTGCAGACTGAGCCAGG + Intergenic
1045425420 8:102061181-102061203 GACCATCTGCAGAATGAGCAGGG + Intronic
1046591127 8:116208700-116208722 CCTCCACTGAGGAATGAACAAGG - Intergenic
1047529989 8:125665731-125665753 CCACAACTTCTGATTGAGCAAGG - Intergenic
1047707668 8:127516789-127516811 ATACAACTGCAGATTGAGCATGG - Intergenic
1047782634 8:128122664-128122686 CCTCAACTGCAAAGAGAGCAAGG - Intergenic
1049378286 8:142299439-142299461 CCTCATCTGCAGAAGGCGCTAGG - Intronic
1049480837 8:142821740-142821762 CCTCTGCGGCAGAATCAGCAAGG - Intergenic
1050298020 9:4226740-4226762 CCTCTACTGAAAAATGAGTAAGG + Intronic
1051283274 9:15465972-15465994 CCTCAATTTCAGAATTAGAAGGG + Intronic
1051674701 9:19547308-19547330 CAGCACCTGCAGAATGGGCAGGG - Intronic
1051694420 9:19752785-19752807 CCTCATCTGTAGTATGGGCATGG - Intronic
1053887222 9:42652866-42652888 CCTCACCTGTAGAATGGGAATGG + Intergenic
1054226242 9:62460317-62460339 CCTCACCTGTAGAATGGGAATGG + Intergenic
1056574871 9:87848390-87848412 CCTCAACTGCAAAGTGGCCATGG - Intergenic
1057943268 9:99303359-99303381 CCAAAACTACAGAATGAGGAAGG - Intergenic
1058120634 9:101134969-101134991 CCTCATCTGCAAAATGGGGAAGG - Intronic
1058632952 9:107008136-107008158 CCCCAACTGCATAATGAGAGGGG - Intronic
1060000968 9:119958372-119958394 CCACATCTGCAGAGTGAGGATGG - Intergenic
1060509355 9:124220872-124220894 CCTCCACTGCAGCATGGGGAGGG + Intergenic
1060588308 9:124800427-124800449 CCTCATCTGCCAAATGGGCAGGG - Intronic
1060598040 9:124859804-124859826 CCTCATCTGAAAAATGAGCATGG + Intronic
1060934233 9:127506374-127506396 CCCTAACTGCGGAAGGAGCAGGG + Exonic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1187121900 X:16417317-16417339 CCTCACCTGTAAAATGAGAATGG - Intergenic
1188354405 X:29173667-29173689 CCGCAAATTCAGAATTAGCATGG + Intronic
1190115647 X:47624789-47624811 CCTCATCTGCAAAATGAGAATGG + Intronic
1192810378 X:74542024-74542046 CTTCAAGTTCAGAATGTGCATGG - Intergenic
1193602437 X:83524271-83524293 CCCCATCTGCAAAATGAGCAAGG - Intergenic
1193845283 X:86462662-86462684 CCTGCTCTGAAGAATGAGCAGGG - Intronic
1195840281 X:109168448-109168470 CCACAACTGAAGTGTGAGCAGGG - Intergenic
1198332311 X:135633109-135633131 CCCCAACTCCACAATGGGCAGGG - Intergenic
1198333583 X:135644716-135644738 CCCCAACTCCACGATGAGCAGGG + Intergenic
1198399681 X:136256802-136256824 CCTCATCTGTAAAATGAGGATGG - Intergenic
1198585439 X:138115609-138115631 ACTCAACTACAAGATGAGCAAGG + Intergenic
1199388471 X:147250956-147250978 CCTGAACCACAGAATAAGCAGGG + Intergenic
1199513063 X:148644429-148644451 CCTCATCCGCAAAATGAGGATGG + Intronic
1199902520 X:152190427-152190449 GCTCATCTTCAGAATGAACATGG + Intronic
1200232819 X:154452914-154452936 CTTCAGCTGCAGAGTCAGCATGG + Intergenic