ID: 1077749895

View in Genome Browser
Species Human (GRCh38)
Location 11:4955312-4955334
Sequence GTATCTCAGAGGATTGTGGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 1, 2: 0, 3: 20, 4: 190}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077749889_1077749895 16 Left 1077749889 11:4955273-4955295 CCCTATTTGGGCAACTCTGACAG 0: 2
1: 0
2: 2
3: 9
4: 130
Right 1077749895 11:4955312-4955334 GTATCTCAGAGGATTGTGGATGG 0: 1
1: 1
2: 0
3: 20
4: 190
1077749890_1077749895 15 Left 1077749890 11:4955274-4955296 CCTATTTGGGCAACTCTGACAGT 0: 2
1: 0
2: 0
3: 12
4: 94
Right 1077749895 11:4955312-4955334 GTATCTCAGAGGATTGTGGATGG 0: 1
1: 1
2: 0
3: 20
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077749895 Original CRISPR GTATCTCAGAGGATTGTGGA TGG Exonic
901568958 1:10143528-10143550 GTATCTTGGATGATTTTGGAGGG - Intronic
902116081 1:14122472-14122494 GAATCTCAGAGGATTGTGATGGG - Intergenic
904303793 1:29573876-29573898 GCATCTCAGAGATATGTGGAGGG + Intergenic
904807714 1:33143439-33143461 GGATCTGAGAGGATGGGGGAGGG + Intergenic
905109753 1:35586726-35586748 GTATCACAGAGGTTTCTGGCTGG + Intronic
907667613 1:56447145-56447167 GAATCCCGGAGGATAGTGGAAGG + Intergenic
913439473 1:118882665-118882687 CTATCTCACAGAATTGTGGGAGG + Intergenic
913475558 1:119233654-119233676 GAATTTTAGAGGATTGTAGATGG + Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914824280 1:151130503-151130525 GTCCCTCAGAGGACTGTGAAAGG + Intergenic
915791779 1:158680123-158680145 TTATTTCGGAGGATTGAGGAAGG - Intronic
915860573 1:159440165-159440187 GTATCTCAGGGGGTTGCAGATGG - Exonic
915874544 1:159598671-159598693 GTATCTCAAGGGATTGCAGATGG - Intergenic
916242586 1:162655057-162655079 GTATCCCAGAGGATCTCGGAGGG - Intronic
917797829 1:178544317-178544339 GAAGCTCAGAGGATTGGGAATGG - Intronic
921276620 1:213526924-213526946 GGATATCATAGAATTGTGGAAGG - Intergenic
922093170 1:222417112-222417134 ATATCTCATAGAATTGTTGAAGG - Intergenic
922321757 1:224494866-224494888 GTCTCTCAGATGTTTTTGGAGGG + Intronic
922450056 1:225729677-225729699 TTATCTGAGAGGACAGTGGAAGG - Intergenic
923964469 1:239121783-239121805 GTTTGTCAGAGGAATGTGGTTGG + Intergenic
924030707 1:239882481-239882503 CTATCTCATAGGATTGTGCGGGG - Intronic
924858316 1:247896434-247896456 GTAGATGAGAGGATTGAGGAGGG - Exonic
924901492 1:248406518-248406540 GTATCTCAGAGGGTTGCAAATGG - Exonic
1063229899 10:4054800-4054822 GAATCTCAGATGACAGTGGAGGG + Intergenic
1064856605 10:19775450-19775472 AAATCTCAGAGAATTGAGGAAGG + Intronic
1069373695 10:67772639-67772661 GTACATGAGAGGATTCTGGAAGG - Intergenic
1076265723 10:129108616-129108638 GCATCTCAGAGGACTGCAGAAGG - Intergenic
1077663116 11:4086533-4086555 GGATCTCAGAGGTTGGTAGAGGG + Exonic
1077713531 11:4558916-4558938 ATATCTCAGAGGTTTATTGAAGG - Intergenic
1077746111 11:4907743-4907765 GTATCTTAAGGGATTGTGAATGG - Exonic
1077749303 11:4946699-4946721 GTATCTCAGAGGGTTGTGGATGG + Exonic
1077749895 11:4955312-4955334 GTATCTCAGAGGATTGTGGATGG + Exonic
1077751331 11:4973483-4973505 GTATCTCAGGGGGTTGCAGATGG + Intronic
1077780516 11:5323908-5323930 ATATCTCAAAGGATTGCGGATGG + Exonic
1078401246 11:11029268-11029290 GTGACTCAGAGGAAAGTGGAGGG + Intergenic
1079423956 11:20322855-20322877 AACTCTCAGAGGATTCTGGAAGG + Intergenic
1080045458 11:27803180-27803202 GTAACTCACAGGGTTGTGGCAGG - Intergenic
1080672292 11:34392224-34392246 GTATCCCAGAGGTTTTGGGAGGG + Intergenic
1083105283 11:60351605-60351627 GTATCTGAGAGAAATGTGAAAGG - Intronic
1083139763 11:60712233-60712255 GTATCCCAGAGCACTGAGGAGGG - Intronic
1083151843 11:60796584-60796606 GTACCTCAAAGGGTTGTTGAGGG - Intronic
1090195502 11:124812964-124812986 GAATACCAGAGGATTTTGGAAGG - Intergenic
1093685617 12:22050330-22050352 GTGCCTCACAGGCTTGTGGAGGG + Intronic
1095413863 12:41953945-41953967 ATGTCTAAGAAGATTGTGGATGG + Intergenic
1095817763 12:46443314-46443336 CTATCTCATAGGAGTGTGTATGG + Intergenic
1098437212 12:70480677-70480699 GTATCTCATAGGATTCTTGGAGG + Intergenic
1098455295 12:70666085-70666107 CTACTTCAAAGGATTGTGGAAGG - Intronic
1098828872 12:75334520-75334542 GTAGCTCAGAGCTTTGTGGAAGG + Intronic
1099011391 12:77295362-77295384 GGATCACAGAGAATTGGGGAAGG + Intergenic
1099810283 12:87572313-87572335 GTTTCTCAGATGATTTTGTAGGG - Intergenic
1100567155 12:95807455-95807477 ATATCTTAGAAGATTGTGGTAGG + Intronic
1100797552 12:98198298-98198320 ATTTCTCATAGGATTGTGGAAGG - Intergenic
1100854843 12:98749698-98749720 GCATCACAGAGGACTGTGGTGGG + Intronic
1101806888 12:108071930-108071952 GTATCTCAGGGGAGTGTTAATGG - Intergenic
1103732584 12:123037685-123037707 GAATCTGAGAGGATTGAGAAAGG - Intronic
1106768198 13:32937155-32937177 GATTCACAGAGGTTTGTGGAGGG - Intergenic
1108057869 13:46503066-46503088 GAATCTCAGAGCATTGTGTTAGG + Intergenic
1111542503 13:89687893-89687915 GAAGCTCAGATGATTGTGGCAGG + Intergenic
1112416055 13:99204466-99204488 GTCTTTCAGAGGACAGTGGAAGG + Intronic
1115399564 14:32941094-32941116 ATTTCTCAGAGCATTGTGCAAGG + Intronic
1117440591 14:55755536-55755558 TTATCTCAGACTATTCTGGAAGG - Intergenic
1118475737 14:66115180-66115202 CAGCCTCAGAGGATTGTGGAGGG + Intergenic
1119431999 14:74574668-74574690 GTATCTCAGAGATTTGTTTAGGG + Intronic
1120457237 14:84747279-84747301 GTGTATCAGAGCATTCTGGAAGG - Intergenic
1121628208 14:95402340-95402362 TTATCTCAAAGGAATGTGGTTGG - Intergenic
1123945153 15:25235381-25235403 GTGTCTGAGAGGTGTGTGGATGG + Intergenic
1124217253 15:27817607-27817629 GTTTCTAAGAGGATCATGGAGGG - Intronic
1124583709 15:30986011-30986033 ATTTTTCAGAGGATGGTGGAAGG + Intronic
1125866153 15:43051413-43051435 GTCTATCAGAGGATTGAGGTTGG + Intronic
1127379152 15:58414564-58414586 ATTTCTCACAGGTTTGTGGATGG - Intronic
1127715234 15:61643251-61643273 GCATCTTAGAAGATCGTGGATGG + Intergenic
1129241282 15:74253562-74253584 GTATCTCACAGGTTTCTGGATGG - Intronic
1129930584 15:79407343-79407365 GTATCTCAAAGGTTTGGGGCAGG - Intronic
1130095017 15:80849458-80849480 GTGACTCAGAGGTTTGTGGCTGG - Intronic
1130741586 15:86606285-86606307 GTTTCTAAGGAGATTGTGGAAGG - Intronic
1130868348 15:87951070-87951092 GTTGCTCAGAGGACAGTGGATGG - Intronic
1130886089 15:88093921-88093943 GTTTCCCATAGGATTGGGGAAGG - Intronic
1131767690 15:95697896-95697918 GTGGCTCAGAGTATTTTGGAGGG - Intergenic
1132220500 15:100101618-100101640 GTGTGTCAGAGGATGGGGGAAGG - Intronic
1134396389 16:13868249-13868271 GTTTCTCAGGGGTTTGAGGAAGG - Intergenic
1135177509 16:20243798-20243820 GAAGCTAAGAAGATTGTGGAAGG - Intergenic
1135772925 16:25231036-25231058 CTATCTCATAGGATTGTCGTAGG - Intergenic
1136563575 16:31055986-31056008 GTTTCTAAGGGGACTGTGGAGGG + Intergenic
1138774145 16:59700522-59700544 ATAGCTCAGAAGAGTGTGGAAGG + Intergenic
1148100483 17:45087491-45087513 ATATCTAAAAGGATTCTGGAAGG + Intronic
1148220774 17:45860261-45860283 GTCTCTAAGGGGATTGTGGAGGG + Intergenic
1155573547 18:27220947-27220969 GGATGTCAGATGATAGTGGAAGG + Intergenic
1162393122 19:10401724-10401746 GTATTCCAGAGTATTCTGGAAGG + Intronic
1162584519 19:11550986-11551008 CTCTCCCAGAGGCTTGTGGATGG + Intergenic
1164208473 19:23077025-23077047 GTCTTTCGGAGGAATGTGGATGG + Intronic
1165785538 19:38459552-38459574 TTATCTCAGAGGTTACTGGAAGG - Intronic
1166841826 19:45702069-45702091 CTATCTTAGAGTATTGTTGAGGG + Intronic
1167341412 19:48918681-48918703 GTATCTCAGGGGACCGAGGACGG - Intronic
927450542 2:23205905-23205927 CCATCTCAGAGGAGTGTGCAGGG - Intergenic
928101429 2:28439787-28439809 GTGTGGCAGAGGAGTGTGGAGGG - Intergenic
930402263 2:50905267-50905289 GTGTGTCAGAGGGTTGGGGATGG - Intronic
931238228 2:60429796-60429818 GTTTCTCATAGGGTTTTGGATGG - Intergenic
931697658 2:64883617-64883639 TTATCCCAAAGGAGTGTGGATGG + Intergenic
933779646 2:85792518-85792540 GTGTCTCTGAGGATTCTCGAGGG + Intergenic
936729389 2:115361647-115361669 GGATCTCAGAGGTCTGTGGCAGG + Intronic
937930931 2:127204808-127204830 GTTTCTCAGAGGGTCGTGGCAGG + Intronic
938739405 2:134217029-134217051 CTATCTCTGTGGATTGTAGATGG + Intronic
939731893 2:145795056-145795078 ATATTTCAGAGGAGAGTGGATGG - Intergenic
940148083 2:150568666-150568688 ATATGGCAGAGGATTGAGGATGG - Intergenic
941717091 2:168775813-168775835 GTGTCTCAGAGGAATGTTGGTGG - Intergenic
943992219 2:194711127-194711149 GTATTTCAGTGGATTGTGAAAGG + Intergenic
947434029 2:230057167-230057189 TTATCTCAGAGCATTGTTAAGGG + Intronic
1171166195 20:22974093-22974115 GTTTTTAAGAGGACTGTGGAGGG - Intergenic
1173207062 20:41003391-41003413 GTATTTCATAAGAATGTGGAGGG - Intergenic
1173850039 20:46211930-46211952 GCATCTCAGAGGGTTGATGAAGG + Intronic
1174219701 20:48944403-48944425 GTACCTCAGAGGGCTGTCGAGGG - Intronic
1175594710 20:60221833-60221855 GTATCTCCAAGGCTTGTGGGTGG + Intergenic
1175902529 20:62365809-62365831 CTATCTCAGAGGACTGTGCTGGG + Intronic
1180244502 21:46537974-46537996 ATGTCTCAGAGCAGTGTGGAGGG + Intronic
1183163559 22:36131078-36131100 GTTTCTCAGAGGATCAGGGAGGG - Intergenic
1183753371 22:39735688-39735710 CTACCTCAAAGGATTGTGGTGGG + Intergenic
949401424 3:3668929-3668951 GGAAATCAGAGCATTGTGGAAGG - Intergenic
950889337 3:16389101-16389123 GTAAATCAGAGGATGGTGGGGGG - Intronic
955209209 3:56925323-56925345 GTAGCTCAGAGAATTTCGGAAGG - Intronic
956609662 3:71109824-71109846 GTATCACAGACGATTGCTGAAGG - Intronic
957845761 3:85732734-85732756 CTATCTCAGAGGGTTTTGTATGG - Intronic
959560305 3:107772193-107772215 CTATCTCAGAGGATTCTGTGTGG - Intronic
959687503 3:109163544-109163566 CTATCTCATAGGGTTGTGGTGGG + Intergenic
962603100 3:137010213-137010235 GGATCTCATAGGTTTGCGGAAGG + Exonic
965257548 3:166434516-166434538 GACTATCAGAGGTTTGTGGAGGG - Intergenic
965956622 3:174377895-174377917 GCATCTCTGCGGATGGTGGAGGG - Intergenic
968958206 4:3729877-3729899 GAAGCTCAGAGGATGGTGGGGGG + Intergenic
969099192 4:4756281-4756303 GTATCTCACAGGAATGTGGGAGG - Intergenic
969874717 4:10127553-10127575 GTTTCTCAGGGGGTTGTGGCAGG + Intergenic
970027176 4:11635924-11635946 CCATCTCATAGGATTCTGGATGG + Intergenic
970071315 4:12162774-12162796 GCATCTCAGAGCACTGAGGAGGG - Intergenic
970480630 4:16469672-16469694 GCCTGTCAGAGGATTGGGGATGG + Intergenic
971373545 4:26037789-26037811 GTATCTCAAAGGAGTGAGTATGG - Intergenic
972599508 4:40559663-40559685 GGACCTTAGAGGATGGTGGAGGG - Intronic
973109856 4:46384314-46384336 CAATATCAGAGGATTGAGGAAGG + Intronic
975144115 4:70948882-70948904 GAAGCTCAGAGCATGGTGGAGGG - Intronic
976128392 4:81857602-81857624 AGATCTAAGAGGATTGTGTATGG - Intronic
976411811 4:84721881-84721903 CTATCTTAGAGGATTGTTGGAGG + Intronic
977080295 4:92518530-92518552 GGATGCCAGAGGATTGTGGGAGG + Intronic
978037854 4:104018348-104018370 CAATCTCAGAAGATTCTGGAAGG + Intergenic
978584202 4:110260311-110260333 GAATCTCAGAGGAATCTGGATGG + Intergenic
979761972 4:124417527-124417549 CTATCTCTGAGTATTGTGGTTGG + Intergenic
980867687 4:138572661-138572683 CTATCTCAGAGGGTTGTTGAGGG + Intergenic
982049625 4:151487707-151487729 GTATCTCAAAGGATTTTGTAAGG - Intronic
982309783 4:153972851-153972873 GAACTTCAGAGGACTGTGGACGG - Intergenic
985938499 5:3114997-3115019 GTATCTCAGAGCAGCATGGAAGG - Intergenic
986501115 5:8400962-8400984 GAATCTCAGAGGATCAGGGATGG + Intergenic
988965014 5:36407325-36407347 GGGTCTCAGATGAATGTGGAGGG - Intergenic
989097245 5:37792825-37792847 GTGTCTTAGTGGATTGTGAAAGG + Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
989999122 5:50872533-50872555 GTACCTCAGAGGGTTGTGGGAGG - Intergenic
990632011 5:57680592-57680614 CCATCTCTGAGGATTGTGTAGGG - Intergenic
990733008 5:58830033-58830055 GTAACTCAGAGGATAAAGGAAGG + Intronic
991984148 5:72266040-72266062 GTATCTCATAGGACAGAGGAGGG + Intronic
995736905 5:115311357-115311379 GTATCTCACAGGTGGGTGGAAGG + Intergenic
995956014 5:117777298-117777320 GCATCTCAGAGGAATGGGGAAGG + Intergenic
996484212 5:124012404-124012426 GTGTTTCAGAGAATAGTGGATGG + Intergenic
996614621 5:125425802-125425824 CTACCTCATAGGATTGTTGAAGG + Intergenic
1000153552 5:158527854-158527876 GTGTCTGGGGGGATTGTGGAAGG + Intergenic
1000452681 5:161409477-161409499 TTATCTGAGAGGGTTGTGGAAGG + Intronic
1001404029 5:171462936-171462958 GTATCCAGGAGGATTGTGGTAGG - Intergenic
1001486339 5:172122304-172122326 GAATCTTGGAGGATGGTGGATGG - Intronic
1007169296 6:39851423-39851445 TTATCTCAGAGAGTTGTCGAGGG + Intronic
1007865570 6:44965772-44965794 GTATTTAAGATGATAGTGGAAGG - Intronic
1008158862 6:48052526-48052548 GTATCTCCAAAAATTGTGGAGGG - Intronic
1010266092 6:73869632-73869654 GTAGCTTAGAGGATGGTAGATGG - Intergenic
1011202695 6:84854896-84854918 GTTTCTCAGATGTTTGTGGGCGG - Intergenic
1017206176 6:151806992-151807014 GAATCTCAGAAGGTTGTGGAAGG + Intronic
1019142526 6:169957320-169957342 GTATCTGAGAGGGTTGTGGTGGG + Intergenic
1021275755 7:18648755-18648777 GTGTCTAAGAGGAATGTTGATGG + Intronic
1022767916 7:33436005-33436027 CTATCTCAAAGAATTGGGGAAGG - Intronic
1022977789 7:35574920-35574942 GTGTCTCAGGGGAGTGTGGCAGG - Intergenic
1023496839 7:40806864-40806886 GTATCTCAGAGGATGCAGCATGG + Intronic
1023678008 7:42650986-42651008 GTATCGCTGAGGTTTGTGCAGGG - Intergenic
1024624549 7:51194103-51194125 GTCTCTCAGAGGATGGAGGGTGG - Intronic
1024704922 7:51946755-51946777 GGTTCTGAGAGGTTTGTGGAAGG + Intergenic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1030648607 7:112092356-112092378 ATATTTCACAGGATTGTTGAGGG - Intronic
1031173675 7:118322176-118322198 ATCTTTAAGAGGATTGTGGAAGG + Intergenic
1032500145 7:132394027-132394049 GGCTGTCAGAGGATTGGGGAAGG - Intronic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034333185 7:150301018-150301040 CTATCTCAGAGGGTTGTTGGTGG + Intronic
1034383498 7:150719532-150719554 GTTTCTCAGAGGCCTGTTGAGGG - Intronic
1034664856 7:152808871-152808893 CTATCTCAGAGGGTTGTTGGTGG - Intronic
1042403868 8:68380849-68380871 GTATCTCAGAAGATTGTTTTGGG + Intronic
1043221183 8:77666929-77666951 GATTCACAGAGGATTGTGGAAGG + Intergenic
1043396348 8:79841877-79841899 TTATCTCAGAGGATTGTGTGAGG + Intergenic
1045770848 8:105738170-105738192 GTCTATCAGAGGATTGAGGGTGG - Intronic
1047205895 8:122802808-122802830 GTATCCCAGAGAAGCGTGGAAGG - Intronic
1047644747 8:126858243-126858265 GGCACTCATAGGATTGTGGATGG + Intergenic
1047766039 8:127990846-127990868 GTGTCTGTGAGGATGGTGGAGGG + Intergenic
1049054705 8:140226671-140226693 GTATCTCAATGTGTTGTGGAAGG - Intronic
1049843739 8:144789892-144789914 GCATCTCTGCGGATGGTGGAGGG + Exonic
1056570024 9:87806745-87806767 GCATCGCTGAGGATTGTGGTGGG - Intergenic
1058391875 9:104504636-104504658 GTATCTCAGGGGGTTGCAGATGG - Exonic
1058393863 9:104526814-104526836 GTATCTCAGAGGGTTACAGATGG + Exonic
1058394589 9:104536328-104536350 GTATCTCAGTGGGTTGCAGATGG + Exonic
1058398882 9:104590387-104590409 ATATCTCAGAGGGTTGCAGATGG - Intergenic
1058629263 9:106969749-106969771 GTCTCTGGGTGGATTGTGGATGG + Intronic
1059735682 9:117097215-117097237 CAAACTCAGAGGAGTGTGGAGGG + Intronic
1059993430 9:119886642-119886664 CTATCTCAGAGGTTTGTGGTGGG - Intergenic
1061529825 9:131201921-131201943 CTTTCTCAGAAGACTGTGGAAGG - Intronic
1062138244 9:134940960-134940982 CTATCTCAGAGGTTTCTGCAGGG + Intergenic
1062478422 9:136740798-136740820 GGATGGCAGAGGATGGTGGAGGG - Intronic
1189493200 X:41485878-41485900 TTATGTCAGAGGATTGTTAAAGG - Intergenic
1190855323 X:54288621-54288643 ATATCTCAGAGGGCAGTGGAAGG - Intronic
1193546018 X:82830407-82830429 TAATCTCAGAGGATCGTGGAAGG - Intergenic
1194469722 X:94278159-94278181 GTACCTCACAGGACTATGGAGGG + Intergenic
1195390587 X:104358071-104358093 GTTTTTAAGCGGATTGTGGAGGG + Intergenic
1198920926 X:141725880-141725902 GTATTTCTGAGGATGGTAGATGG + Intergenic