ID: 1077750981

View in Genome Browser
Species Human (GRCh38)
Location 11:4969793-4969815
Sequence CTGATAACTCAGAAGATACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 214}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077750980_1077750981 15 Left 1077750980 11:4969755-4969777 CCAAGTAAAGTAAAATATGCTTT 0: 1
1: 0
2: 2
3: 39
4: 454
Right 1077750981 11:4969793-4969815 CTGATAACTCAGAAGATACAAGG 0: 1
1: 0
2: 0
3: 19
4: 214
1077750979_1077750981 16 Left 1077750979 11:4969754-4969776 CCCAAGTAAAGTAAAATATGCTT 0: 1
1: 0
2: 5
3: 46
4: 476
Right 1077750981 11:4969793-4969815 CTGATAACTCAGAAGATACAAGG 0: 1
1: 0
2: 0
3: 19
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077750981 Original CRISPR CTGATAACTCAGAAGATACA AGG Intronic
901053081 1:6435420-6435442 CTGATTACACAAAAGAAACATGG - Intronic
902340664 1:15781583-15781605 CTGTTAACTAAGAAGAAAAATGG + Intronic
902457276 1:16543914-16543936 GTGATAACTAAGAGGACACAGGG + Intergenic
902481160 1:16712629-16712651 CTGATTACACAAAAGAAACATGG + Intergenic
902483943 1:16729353-16729375 GTGATAACTAAGAGGACACAGGG - Intergenic
902494890 1:16863998-16864020 GTGATAACTAAGAGGACACAGGG - Intronic
902832599 1:19027140-19027162 ATGGAAACTCAGAAAATACAGGG + Intergenic
903201020 1:21738938-21738960 CTGAAAACACTGAAGATACTGGG + Intronic
904254165 1:29244019-29244041 GTGATGACTCAGAAGGGACAAGG + Intronic
905943495 1:41883080-41883102 CTGGTCACACAGAAAATACAGGG + Intronic
906574450 1:46875336-46875358 CCAATAACTCAGAAGATAAATGG + Intergenic
906597521 1:47092568-47092590 CCAATAACTCAGAAGATAAATGG - Intronic
908161288 1:61410953-61410975 CTGATAATACAGAAGACACTTGG - Intronic
908704963 1:66943201-66943223 TTGAAAACTCAGAAGAGAAAAGG + Intronic
908736980 1:67286715-67286737 CAGATAACTCAAAAGAAAAATGG - Intergenic
909468672 1:76002404-76002426 GTAATATCTCAGAAGATGCAGGG + Intergenic
909636574 1:77823236-77823258 CTGATAACTCAGAAGTTTTTTGG - Intronic
910117017 1:83742686-83742708 CTGATTACTCAGAAGTCACAAGG + Intergenic
910465621 1:87496200-87496222 CTGTTAACACAGAAGAGACCAGG + Intergenic
911316216 1:96359571-96359593 CTGCTCTCTCAGAAGATACAAGG + Intergenic
912050513 1:105523530-105523552 ATGCTAACTCAGACCATACATGG + Intergenic
912140829 1:106724678-106724700 TTGCTAACTCAGAAGATAAATGG + Intergenic
912759813 1:112356895-112356917 CTGAAGACCCAGAAGACACAGGG + Intergenic
912921816 1:113875717-113875739 TTGATAAATCTGAAAATACAGGG - Intergenic
914360433 1:146931282-146931304 CTGTTAACACAGAAGAGACCAGG + Intergenic
914493314 1:148168616-148168638 CTGTTAACACAGAAGAGACCAGG - Intergenic
918432110 1:184471792-184471814 CTATTAACTCCAAAGATACAAGG - Intronic
918470575 1:184868793-184868815 CTGCTGACTGAGAAGACACATGG + Intronic
918737703 1:188087216-188087238 TTAATAGCTCAGAAGATAAACGG + Intergenic
919430858 1:197489327-197489349 CTTATAAGCCAGAAGACACAGGG + Intergenic
923582438 1:235230941-235230963 CTTATAACACAGAAGACACATGG + Intronic
924077808 1:240359177-240359199 CTGATAAACTAGAAGAAACATGG - Intronic
1063186825 10:3659403-3659425 CTTACAACACAGAAGATTCAGGG + Intergenic
1063300920 10:4848247-4848269 CTGATAAGTCAGATTATACCTGG + Intergenic
1064276336 10:13908750-13908772 CTGATAACTGAGTAAAAACATGG - Intronic
1064820328 10:19322701-19322723 CTGAGCACTCAGTAAATACATGG + Intronic
1065713723 10:28543762-28543784 CTCTTAAATGAGAAGATACAAGG - Intronic
1073638135 10:105220387-105220409 CTGATACCCAAGAAGATAAAAGG - Intronic
1073947829 10:108771970-108771992 GTGAAAACTCAGGAGATAAAAGG + Intergenic
1074506625 10:114076691-114076713 CTGAAAACAGAGTAGATACATGG - Intergenic
1075110888 10:119582638-119582660 CTGATAGCTGGGAATATACAAGG + Intronic
1076318376 10:129559673-129559695 CTGATGACTAAGATGATATATGG - Intronic
1077750981 11:4969793-4969815 CTGATAACTCAGAAGATACAAGG + Intronic
1078386443 11:10897209-10897231 ATGTTAAGTCAAAAGATACAGGG + Intergenic
1080442996 11:32312679-32312701 CTGATAACACAGTTGATTCATGG - Intergenic
1083360747 11:62105876-62105898 GTGATAAATCTGAAGATAAATGG - Intergenic
1084467937 11:69337827-69337849 CAGATAACTCAGTAAATATATGG - Intronic
1085534333 11:77208974-77208996 CTGAAGAATCAGAAGATACAAGG - Intronic
1086559557 11:88152164-88152186 GTGATAACTCAGAACTTCCAAGG + Intronic
1087974571 11:104529013-104529035 CTGATATCTTACAATATACAAGG - Intergenic
1088781998 11:113144311-113144333 TTGATGACTCAGGAGACACATGG - Intronic
1090756868 11:129799569-129799591 CTGATAAGCCAGAAGGTACTGGG + Intergenic
1090993795 11:131845962-131845984 CAGATAACTCAAAAGCTAAATGG - Intronic
1091178627 11:133583172-133583194 CTGATAATTCAGGAGAGAAAAGG + Intergenic
1091203218 11:133798593-133798615 TTGCTAACTCTGAAGATGCAGGG - Intergenic
1094709912 12:32951701-32951723 CGCATAACTCAGAAAATAAATGG - Intergenic
1095326605 12:40902274-40902296 CTGACACCTCAGAAGATGAAGGG + Intronic
1095815642 12:46419374-46419396 CTGAGATCTAAGAAGATACTTGG - Intergenic
1098373875 12:69791226-69791248 CTGTAAACTCAGAAGAAACAAGG + Intronic
1100871909 12:98918366-98918388 ATGAATACACAGAAGATACAAGG + Intronic
1101422557 12:104561661-104561683 ATAATAATACAGAAGATACAGGG - Intronic
1103258726 12:119565747-119565769 CTGAAAACTCAGCAGCTAAAAGG + Intergenic
1103306033 12:119964876-119964898 CTGATAAATCAGAACATTCTGGG + Intergenic
1106381310 13:29242546-29242568 CAGATAATTCAGAGGAGACAGGG - Intronic
1108786816 13:53913365-53913387 TTGCTAAGTAAGAAGATACATGG - Intergenic
1108948354 13:56053531-56053553 CTGATAACAGAGAAAAAACAAGG + Intergenic
1110424385 13:75349842-75349864 TTAATAAATCAGAAGTTACAGGG - Intronic
1110689908 13:78420920-78420942 CTGAGAACTCAGAAGCTGTATGG - Intergenic
1112674346 13:101681381-101681403 CTGTAAACTCAGAAGCCACAGGG - Intronic
1113184495 13:107672514-107672536 CTGATATCAGAGAAGATACTGGG + Intronic
1114688472 14:24557830-24557852 TTGAAGACTTAGAAGATACAAGG - Intergenic
1115272781 14:31572509-31572531 CTTATGACTTAGAAAATACATGG + Intronic
1115353338 14:32421143-32421165 TTGAAACCTCAGAAGATGCAGGG - Intronic
1115402372 14:32976819-32976841 CTGAGAAATCAGAAGAATCAAGG + Intronic
1116167772 14:41355235-41355257 CTGCTAACTCAGAAAGTACTGGG + Intergenic
1118458507 14:65966698-65966720 CTGATAACACAGAAGAGCCCTGG + Intronic
1120188144 14:81415869-81415891 CTGAGAACTCAGAAAAAGCAAGG + Intronic
1120795687 14:88630645-88630667 CTGCGAACTGAGAAGATACTAGG - Intronic
1121979803 14:98444703-98444725 TTCATAACTCAGAAGAGTCAGGG - Intergenic
1122642843 14:103170710-103170732 CTGAGCACTCGGAAGAAACAGGG + Intergenic
1123663129 15:22583573-22583595 CTTGTAACTCAGAATATATAAGG + Intergenic
1124316931 15:28677876-28677898 CTTGTAACTCAGAATATATAAGG + Intergenic
1126993057 15:54406017-54406039 CTGAGGACTCAGAGGATAGAAGG - Intronic
1127204011 15:56693913-56693935 CTGATAAGACAGAAGATTCCTGG - Intronic
1139347052 16:66310706-66310728 GTGGGAACTCAGATGATACAGGG + Intergenic
1140623249 16:76762301-76762323 CAGAAAACTCAGAAGGTAAAGGG - Intergenic
1140957828 16:79882818-79882840 ATTATAACTCTGAAGATAGATGG + Intergenic
1145858158 17:28182546-28182568 CTGACAAACCAGAAAATACAAGG + Intronic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1147782683 17:42954979-42955001 ATGGTAACTCAGTAGATAAATGG + Intronic
1151080763 17:71325868-71325890 CTGATAAGTCTGGAGATGCATGG - Intergenic
1153104741 18:1513495-1513517 CTGATAACTGACAACATCCATGG - Intergenic
1153336364 18:3929959-3929981 CAGATCACTCTGCAGATACATGG + Intronic
1153365195 18:4247940-4247962 CTGAGAACTCAGGATATACTGGG + Intronic
1153840464 18:9003215-9003237 ATGATAACACAGGAGATAGAAGG + Intergenic
1158063519 18:53377112-53377134 TAGATAACACAGAGGATACAAGG + Intronic
1159671371 18:71225132-71225154 CTGAGAAGCCAGAAAATACATGG - Intergenic
1160130019 18:76217434-76217456 CTGACTACTCAGAAAATATATGG + Intergenic
1162552662 19:11366176-11366198 CTGAGAACTCAGCAGATACTGGG + Intergenic
1165201390 19:34147745-34147767 CAGTTCACTCAGTAGATACAAGG - Intergenic
1202708236 1_KI270713v1_random:40474-40496 GTGATAACTAAGAGGACACAGGG + Intergenic
1202715195 1_KI270714v1_random:38533-38555 CTGATTACACAAAAGAAACATGG + Intergenic
928740554 2:34347227-34347249 CTGATAAAACAGAATCTACATGG + Intergenic
929438784 2:41949172-41949194 CTGTTAAACCAGAAGAGACAGGG + Intronic
932343914 2:70983486-70983508 CAGAAAACTCAGAAGATACTGGG + Intronic
933411901 2:81936420-81936442 CTGTAAGCTCAGAAGATATAAGG - Intergenic
934043707 2:88152648-88152670 CTGATAACACAGAAATTAAAAGG + Intergenic
934605105 2:95689029-95689051 CAGAAAACTCAGAAAATATATGG - Intergenic
936538564 2:113331569-113331591 CAGAAAACTCAGAAAATATATGG - Intergenic
936684038 2:114806474-114806496 ACTATACCTCAGAAGATACAGGG + Intronic
936819008 2:116496309-116496331 CTGATAACTCAGATATTAAAAGG + Intergenic
938089843 2:128424369-128424391 CTGATAACTCAGCACAGACATGG - Intergenic
938589734 2:132724730-132724752 CTGATAACTTATAAGAAGCAAGG + Intronic
939311134 2:140478513-140478535 GTGATAACTGAGAATATAAAAGG + Intronic
941562240 2:167061012-167061034 CTGATAAATGAGAAAATAAATGG - Intronic
941782368 2:169459057-169459079 CTCCTAACCCAGAAGATCCACGG + Intergenic
942784633 2:179686717-179686739 CTGATTTCTCACAAGATTCATGG - Intronic
946561159 2:220915465-220915487 CTGCTTGCTGAGAAGATACAGGG - Intergenic
946789461 2:223285461-223285483 CTGCTAACTCAGAAGGGGCAGGG + Intergenic
947940004 2:234045358-234045380 CTGCTAACTGAGAGGATAGATGG - Intergenic
1168860250 20:1041057-1041079 GTTGAAACTCAGAAGATACAAGG - Intergenic
1169924909 20:10772961-10772983 ATTATACCTCAGAAGATAAAAGG - Intergenic
1171727948 20:28643283-28643305 CAGAATACACAGAAGATACAAGG - Intergenic
1172377683 20:34458628-34458650 ATGCTCACTCAGAAGATACTAGG + Intronic
1177101770 21:16906912-16906934 CTGATAATCCAGAATATACAAGG + Intergenic
1177494830 21:21874730-21874752 CTGATAACCCAGTAGAAGCAAGG - Intergenic
1178042148 21:28650804-28650826 ATGTTAACTCAGAAGATGAAAGG + Intergenic
1178274095 21:31220579-31220601 CTGATAACTGAGAATATTTATGG - Intronic
1181433795 22:22898812-22898834 CTGATTACTCAGAGGATAAGAGG + Intergenic
1181434737 22:22904181-22904203 CTGATTACTCAGAGGATAAGAGG + Intergenic
1183498502 22:38164022-38164044 CTGGTATCTCAGCAGAAACAGGG - Intronic
1183755816 22:39763238-39763260 CTGATGATTCTGATGATACAAGG - Intronic
1184486950 22:44785499-44785521 CCAATGACTCAGGAGATACAAGG - Intronic
949451190 3:4187050-4187072 TTGGCAGCTCAGAAGATACATGG - Intronic
949500388 3:4674671-4674693 TTGTTAACTCAGAAGTAACAAGG - Intronic
949876264 3:8627987-8628009 CTGATGTCTCAAAAGAAACAGGG - Intronic
952039303 3:29242119-29242141 CTGATAACTGAGATGAAAAAAGG + Intergenic
952142786 3:30498489-30498511 CTGATTCCTCACAAGATGCAAGG - Intergenic
953258982 3:41319335-41319357 TTGAGAACTCAGTAGAAACAAGG - Intronic
956906653 3:73772804-73772826 CTGATGTCTCTGAAGATAAAAGG + Intergenic
957395506 3:79631737-79631759 CTGATAATCCAGAATCTACAAGG + Intronic
957439997 3:80233209-80233231 CTGATTACTCTGAAGATAGCTGG - Intergenic
957810123 3:85211104-85211126 CTGATAACACAGAAATTAAAAGG - Intronic
959647494 3:108720374-108720396 CTGATAAAACAGATGATTCAAGG - Intergenic
960838107 3:121927973-121927995 GTGATAAATAAGTAGATACAGGG + Intronic
965442566 3:168733364-168733386 CTGATAACTAAAAACAGACAAGG + Intergenic
965671587 3:171153270-171153292 CTAAGAACTCAGAATAGACAAGG - Intronic
968033863 3:195528208-195528230 CTTATAAGTGAGAACATACAAGG + Intronic
968571155 4:1341498-1341520 TGGATAACTCAGAAGGTACAAGG - Intergenic
969256393 4:6004891-6004913 CTGATCACTCAAAATATACCGGG + Intergenic
971689878 4:29819609-29819631 ATGATATTTCAGAAGATATATGG + Intergenic
972884513 4:43469312-43469334 CTGAGCACTCAGAAGAACCAGGG + Intergenic
973077134 4:45943266-45943288 CTGCTAACTCGGAGGGTACATGG - Intergenic
974572330 4:63669175-63669197 CTTACAACTCAGAAGATATTGGG - Intergenic
974718973 4:65711842-65711864 CTGAGAACTCAGATAATCCAAGG + Intergenic
974732165 4:65881643-65881665 CTGAAAATTCTGCAGATACATGG + Intergenic
974819082 4:67043676-67043698 CTGATCACTAAGAGGATACAGGG - Intergenic
976824150 4:89240625-89240647 CTGGTAACTGAGTAGCTACAGGG - Exonic
978820786 4:112962725-112962747 CTAATAAGTCAGAAGCTATAGGG + Intronic
980552087 4:134351700-134351722 CTGATAACACAGAAGTTAGAAGG + Intergenic
980789253 4:137597460-137597482 CTAATAGCGAAGAAGATACAAGG - Intergenic
981432757 4:144680997-144681019 CTAATAATTTAAAAGATACACGG + Intronic
982618476 4:157673738-157673760 TTGAAGACACAGAAGATACAAGG + Intergenic
982944035 4:161595668-161595690 CTGATTAATCAGAATGTACAAGG + Intronic
983588260 4:169379422-169379444 CTGATAACTCAGAAATAAAAAGG + Intergenic
984221028 4:176975518-176975540 CTTAGAACTAAGAATATACAGGG + Intergenic
985869201 5:2540564-2540586 GTGAAAACTTAGAAGACACAGGG - Intergenic
986552358 5:8972577-8972599 ATGATAAATCATAAGATAGAAGG - Intergenic
987298714 5:16577425-16577447 CTGATTCCTCAGAGGCTACAAGG + Intronic
987791659 5:22576101-22576123 CTGAGAACACAGAAGATTCCTGG - Intronic
988308081 5:29519859-29519881 CTGAAAACTCAAAAGAAATAGGG - Intergenic
988457386 5:31398471-31398493 CTGAGAACTCAGAAGAACCAGGG - Intergenic
989112745 5:37922969-37922991 CTGAGAACTCAGAAGGAAGAAGG - Intergenic
989294940 5:39814337-39814359 CTGCTAACTCAGAAAAGACCTGG - Intergenic
989566614 5:42907391-42907413 TTGTTAACTCAGAAGGCACAAGG + Intergenic
992203639 5:74408623-74408645 CTGATACCTCTGAGGACACAGGG + Intergenic
992835756 5:80639785-80639807 CTGATACCTTAGGAGATACCTGG - Intronic
996103271 5:119467821-119467843 TTCATAACTCAGTATATACAAGG - Intronic
997509975 5:134447354-134447376 CCGCTAACTCAGAAGAGTCAGGG + Intergenic
1000699717 5:164433696-164433718 CTGGAAACTCAGAACATACCAGG - Intergenic
1004627522 6:17391000-17391022 CTGATAACACAGTAGACTCAGGG - Intergenic
1009556244 6:65171929-65171951 CTGTTAACTCATAATATTCATGG - Intronic
1011224614 6:85093102-85093124 CTGGTAACTCAGAATTTCCAGGG + Intergenic
1011456630 6:87557520-87557542 CAGATAAATCAGTAGATAGAGGG - Intronic
1012166221 6:95956011-95956033 GTGATAAATCAGAAAATATAGGG + Intergenic
1012452391 6:99366376-99366398 CTCATTGCTCATAAGATACAAGG - Intergenic
1013029091 6:106313119-106313141 CTGAGAAGGCAGAAGATAGAGGG + Intronic
1013642064 6:112094931-112094953 ATGATACCTCAGAAGACAAAAGG - Intronic
1013876567 6:114837910-114837932 CTGATAACACAGAAAATTCATGG - Intergenic
1013983735 6:116165163-116165185 CTGACAAGCCAGAAGAGACAGGG - Intronic
1015126651 6:129762751-129762773 CAGAAAACTTAGAAAATACAGGG - Intergenic
1016249547 6:142023491-142023513 CTAATAACTCAGCAGAGAAAAGG - Intergenic
1016692983 6:146960504-146960526 CTGATTATTCAGAAGATAATTGG - Intergenic
1017027363 6:150192995-150193017 CTGATCACTCAGAATATTCCAGG - Intronic
1017231359 6:152077312-152077334 CTTATATTTCAGAAGATACGTGG + Intronic
1018821035 6:167374689-167374711 CTGATGGCTCAGGAGATTCACGG + Intronic
1020550014 7:9592143-9592165 CTGTTTACTCTGAAGATAGATGG - Intergenic
1022189738 7:28005781-28005803 CAGATAACTGAGAAGGTCCAGGG - Intronic
1022804089 7:33804453-33804475 AAGATAACACAGAAGACACATGG - Intergenic
1023537912 7:41232982-41233004 CTGATAATTCAGAAGATTTTTGG + Intergenic
1026253946 7:68694533-68694555 ATGACAACTGAGAGGATACAGGG - Intergenic
1028874864 7:95810037-95810059 CTGATATCCCAGAAGGGACAAGG + Intronic
1028875590 7:95819539-95819561 CTGATAAATCAGAGGCTAAAGGG + Intronic
1030350933 7:108485706-108485728 ATGACAACTCAGAAGATTGATGG - Intronic
1031240595 7:119233496-119233518 CTCATAACTCAGGAAATACATGG - Intergenic
1031331945 7:120476234-120476256 CTAATAACACAGAAGAGAAAAGG - Intronic
1031751098 7:125575160-125575182 CTGATTAGACAGAATATACAGGG - Intergenic
1032670369 7:134076776-134076798 GTTAGAACTCAGCAGATACATGG + Intergenic
1035471223 7:159110139-159110161 CTTAAAATTCAGAAGGTACATGG - Intronic
1037533233 8:19800193-19800215 CTGATAAATCACAAGTTTCAAGG + Intergenic
1038327370 8:26581773-26581795 CTGATGAGTCAGAACACACAGGG - Intronic
1039838591 8:41277568-41277590 CTGCTGACTCAGAAGCTCCAGGG - Intronic
1042927284 8:73978802-73978824 CTGACAAATCAGAAGATGGAAGG + Exonic
1043031767 8:75143033-75143055 GTGATAACAAAGAAAATACAAGG - Intergenic
1044247244 8:89963251-89963273 CAGAGCACTCAGGAGATACACGG + Intronic
1045562296 8:103276470-103276492 ATGATAGCTCAGGAGTTACATGG - Intergenic
1050754501 9:8984588-8984610 CTGAGAAGTCAGAAGAAAAATGG - Intronic
1052482490 9:29049078-29049100 TTAATAACCCAGAATATACAAGG + Intergenic
1052931616 9:34060356-34060378 CTGAAAATTCAGTAGATAAATGG + Intergenic
1053186663 9:36022186-36022208 ATGATAACTCAGAGGAAAGAAGG + Intergenic
1055300148 9:74874311-74874333 CTGTTAACTCATAAGATTCTTGG - Intronic
1055350705 9:75384097-75384119 CTTATAACCCAAAAGATGCAGGG + Intergenic
1058195848 9:101974313-101974335 TTGATAACTGACAAGATATAAGG - Intergenic
1060623307 9:125087484-125087506 AAGATAACTCAGAAAATACTGGG + Intronic
1061615701 9:131777351-131777373 CTGATAACTGAGAACATAAGCGG + Intergenic
1186834430 X:13423263-13423285 CTAACAGCTCAGAAGAGACACGG + Intergenic
1188877713 X:35451691-35451713 ATTATTACTCAGAATATACAAGG - Intergenic
1190896764 X:54626894-54626916 ATGAAAATTCAGAATATACAAGG - Intergenic
1191156380 X:57278208-57278230 CTGGTAACAAAGAAGATATATGG + Intergenic
1192075296 X:67989108-67989130 CTGAAAACTCAGAAGAGGAATGG + Intergenic
1192604223 X:72497532-72497554 CTGATAAATCAGAAAAGACATGG - Intronic
1193443652 X:81573464-81573486 CTAATACCTAAGAATATACAAGG + Intergenic
1195605209 X:106798743-106798765 CTTATAAATAAGAATATACATGG + Intergenic
1195612142 X:106879813-106879835 CTAATAATCCAGAATATACAAGG + Intronic