ID: 1077754822

View in Genome Browser
Species Human (GRCh38)
Location 11:5015557-5015579
Sequence TGTAATCATTGGGATTGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077754813_1077754822 9 Left 1077754813 11:5015525-5015547 CCCTTGCGCTATGCAGCCATCCT No data
Right 1077754822 11:5015557-5015579 TGTAATCATTGGGATTGGGTTGG No data
1077754814_1077754822 8 Left 1077754814 11:5015526-5015548 CCTTGCGCTATGCAGCCATCCTA No data
Right 1077754822 11:5015557-5015579 TGTAATCATTGGGATTGGGTTGG No data
1077754815_1077754822 -7 Left 1077754815 11:5015541-5015563 CCATCCTAACCAATGATGTAATC No data
Right 1077754822 11:5015557-5015579 TGTAATCATTGGGATTGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077754822 Original CRISPR TGTAATCATTGGGATTGGGT TGG Intergenic
No off target data available for this crispr