ID: 1077760018

View in Genome Browser
Species Human (GRCh38)
Location 11:5084737-5084759
Sequence CCATCACCACTCCAAGACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077760018_1077760027 13 Left 1077760018 11:5084737-5084759 CCATGGTCTTGGAGTGGTGATGG No data
Right 1077760027 11:5084773-5084795 TCAGAGAAAGAAGCCTTTGGGGG No data
1077760018_1077760025 11 Left 1077760018 11:5084737-5084759 CCATGGTCTTGGAGTGGTGATGG No data
Right 1077760025 11:5084771-5084793 TGTCAGAGAAAGAAGCCTTTGGG No data
1077760018_1077760024 10 Left 1077760018 11:5084737-5084759 CCATGGTCTTGGAGTGGTGATGG No data
Right 1077760024 11:5084770-5084792 GTGTCAGAGAAAGAAGCCTTTGG No data
1077760018_1077760026 12 Left 1077760018 11:5084737-5084759 CCATGGTCTTGGAGTGGTGATGG No data
Right 1077760026 11:5084772-5084794 GTCAGAGAAAGAAGCCTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077760018 Original CRISPR CCATCACCACTCCAAGACCA TGG (reversed) Intergenic
No off target data available for this crispr