ID: 1077762918

View in Genome Browser
Species Human (GRCh38)
Location 11:5123098-5123120
Sequence CTGTGGTTATCATGGTGACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077762918_1077762920 -10 Left 1077762918 11:5123098-5123120 CCTAGTCACCATGATAACCACAG No data
Right 1077762920 11:5123111-5123133 ATAACCACAGATTTAAACTCTGG No data
1077762918_1077762922 0 Left 1077762918 11:5123098-5123120 CCTAGTCACCATGATAACCACAG No data
Right 1077762922 11:5123121-5123143 ATTTAAACTCTGGAATGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077762918 Original CRISPR CTGTGGTTATCATGGTGACT AGG (reversed) Intergenic
No off target data available for this crispr