ID: 1077764039

View in Genome Browser
Species Human (GRCh38)
Location 11:5137715-5137737
Sequence ATCCTAGACCTGCTATTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077764038_1077764039 2 Left 1077764038 11:5137690-5137712 CCTGAAGCTGGTCAAAAGAGGTC No data
Right 1077764039 11:5137715-5137737 ATCCTAGACCTGCTATTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077764039 Original CRISPR ATCCTAGACCTGCTATTGCT TGG Intergenic
No off target data available for this crispr