ID: 1077764561

View in Genome Browser
Species Human (GRCh38)
Location 11:5144445-5144467
Sequence TCGCGCTGGTCAGCAAGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077764561_1077764573 25 Left 1077764561 11:5144445-5144467 CCAGCGCTTGCTGACCAGCGCGA No data
Right 1077764573 11:5144493-5144515 GACCCCGCACTCGGAGCAGCCGG 0: 8
1: 222
2: 360
3: 401
4: 385
1077764561_1077764571 3 Left 1077764561 11:5144445-5144467 CCAGCGCTTGCTGACCAGCGCGA No data
Right 1077764571 11:5144471-5144493 CCGGGTGGGCGTGGGCTCGGCGG 0: 86
1: 601
2: 586
3: 370
4: 512
1077764561_1077764569 0 Left 1077764561 11:5144445-5144467 CCAGCGCTTGCTGACCAGCGCGA No data
Right 1077764569 11:5144468-5144490 GTTCCGGGTGGGCGTGGGCTCGG 0: 615
1: 639
2: 402
3: 209
4: 255
1077764561_1077764568 -5 Left 1077764561 11:5144445-5144467 CCAGCGCTTGCTGACCAGCGCGA No data
Right 1077764568 11:5144463-5144485 CGCGAGTTCCGGGTGGGCGTGGG 0: 114
1: 223
2: 761
3: 668
4: 406
1077764561_1077764577 29 Left 1077764561 11:5144445-5144467 CCAGCGCTTGCTGACCAGCGCGA No data
Right 1077764577 11:5144497-5144519 CCGCACTCGGAGCAGCCGGCCGG 0: 137
1: 281
2: 325
3: 316
4: 369
1077764561_1077764567 -6 Left 1077764561 11:5144445-5144467 CCAGCGCTTGCTGACCAGCGCGA No data
Right 1077764567 11:5144462-5144484 GCGCGAGTTCCGGGTGGGCGTGG 0: 121
1: 263
2: 778
3: 665
4: 417
1077764561_1077764572 16 Left 1077764561 11:5144445-5144467 CCAGCGCTTGCTGACCAGCGCGA No data
Right 1077764572 11:5144484-5144506 GGCTCGGCGGACCCCGCACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077764561 Original CRISPR TCGCGCTGGTCAGCAAGCGC TGG (reversed) Intergenic
No off target data available for this crispr