ID: 1077764631

View in Genome Browser
Species Human (GRCh38)
Location 11:5144683-5144705
Sequence CCGGCCGCACAGGAGCCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077764631_1077764640 11 Left 1077764631 11:5144683-5144705 CCCTTGGGCTCCTGTGCGGCCGG No data
Right 1077764640 11:5144717-5144739 CGAGCGCCGCCCCCTGCTCCAGG No data
1077764631_1077764641 12 Left 1077764631 11:5144683-5144705 CCCTTGGGCTCCTGTGCGGCCGG No data
Right 1077764641 11:5144718-5144740 GAGCGCCGCCCCCTGCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077764631 Original CRISPR CCGGCCGCACAGGAGCCCAA GGG (reversed) Intergenic