ID: 1077776432

View in Genome Browser
Species Human (GRCh38)
Location 11:5277051-5277073
Sequence CTCCGCAGGCAGAGCCTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077776432_1077776436 -2 Left 1077776432 11:5277051-5277073 CCATCAAGGCTCTGCCTGCGGAG 0: 1
1: 0
2: 0
3: 18
4: 158
Right 1077776436 11:5277072-5277094 AGGGCTAACTAGCTCTATGCAGG 0: 1
1: 0
2: 0
3: 2
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077776432 Original CRISPR CTCCGCAGGCAGAGCCTTGA TGG (reversed) Intronic
900120760 1:1047768-1047790 CTCCCCAGCCACAGCCTTCAGGG + Exonic
902094137 1:13928663-13928685 ATCCCCATGCAGAGCCTTGCTGG - Intergenic
902301022 1:15502835-15502857 CTCCGAAGGAAGAGCATTGCTGG + Intronic
902626013 1:17676776-17676798 GTGCTCAGGCAGAGCCTTTAGGG - Intronic
903143195 1:21352346-21352368 CAGCGCAGGCTGAGCTTTGAGGG + Intergenic
905028528 1:34866688-34866710 CATCGACGGCAGAGCCTTGAGGG - Intronic
905328418 1:37174956-37174978 GTCTGCAGGCAGGGCCATGAGGG - Intergenic
905400476 1:37699040-37699062 CTGCTCAGGCAGCGCCTTGTTGG + Intronic
906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG + Exonic
907586261 1:55620650-55620672 CTGCAGGGGCAGAGCCTTGATGG + Intergenic
912006186 1:104903940-104903962 CTGCACAGGCAGAGCCCTCATGG - Intergenic
912373682 1:109193019-109193041 CTCCACAGTCACAGCCTGGATGG - Intronic
915251989 1:154597153-154597175 CTCCCCATGCAGGGCCTTCATGG + Exonic
915318017 1:155040634-155040656 CTGCACAGGCAGAGCCTGGGGGG + Intronic
916979155 1:170114957-170114979 CACCGAAGGCAGAGTCTGGATGG + Intergenic
919860671 1:201737723-201737745 CTCAGCAGGGAGGGCCTGGAAGG - Intronic
920649710 1:207827654-207827676 CCCAGCAGGCAGAGCCAGGAGGG - Intergenic
921375780 1:214472019-214472041 CTCCCCAGTCAGAGTCCTGAAGG + Intronic
922155579 1:223037963-223037985 GTCCGCAGGCACAGGCCTGAGGG + Intergenic
1062876364 10:945943-945965 CTCAGCAGGAACAGCCTTGATGG + Intergenic
1063600259 10:7474592-7474614 CTCAGCAGGCAGAGGCCTCAGGG - Intergenic
1070369104 10:75764876-75764898 CTCCACAGCCGGACCCTTGAAGG - Intronic
1071323963 10:84493511-84493533 CTCCATAGACAGAGCCCTGAGGG + Intronic
1071671628 10:87614360-87614382 CTGGCCAGGCAGAGCCCTGAGGG + Intergenic
1072769371 10:98124810-98124832 CTGCAGAGGCAGAGCCTTCATGG - Intergenic
1073293685 10:102425598-102425620 GTCCTGAGGCTGAGCCTTGAGGG - Intronic
1076762846 10:132614168-132614190 GTCCCCAGGCAGAGCCTGGACGG + Intronic
1077776432 11:5277051-5277073 CTCCGCAGGCAGAGCCTTGATGG - Intronic
1077877336 11:6319657-6319679 CTCCGCAGCCAGAGTCTGGGGGG + Intronic
1078143495 11:8707994-8708016 CTCTGCAACCAGAGCCCTGAAGG + Intronic
1078468707 11:11570037-11570059 CTCTGCAAGCAGAGACGTGAGGG + Intronic
1081160601 11:39743633-39743655 CTGCAGAGGCAGAGCCTTCATGG + Intergenic
1084195056 11:67519869-67519891 CTCCCCCAGCAGGGCCTTGAGGG + Exonic
1084888195 11:72224050-72224072 ACCCGCAGGCCGGGCCTTGAGGG - Intronic
1085814938 11:79727672-79727694 CACTGCAGTCAGAGCCTTGGTGG - Intergenic
1095137511 12:38623564-38623586 CTAAGCAGGCAAAGCCTTGGTGG - Intergenic
1100191819 12:92200902-92200924 GTCTACAGGCAGAGCCTTGGGGG + Intergenic
1100331903 12:93590717-93590739 CCCAGCAGGCAGAGCCGAGATGG + Intergenic
1102772235 12:115488086-115488108 CTGCGCAGGTTGAGTCTTGAAGG + Intergenic
1107065915 13:36214382-36214404 CTCCCCAGGCCGGGCTTTGAGGG + Intronic
1113887737 13:113669889-113669911 TTCCACAGGCAGAGCCATGGTGG + Intronic
1114476457 14:22998601-22998623 CACGGCAGACAGAGCCTTAAAGG + Exonic
1114653841 14:24304049-24304071 GGCCGCAGCCAGAGCCTTGGGGG + Exonic
1118736351 14:68704325-68704347 CTCCGCAGGAGGAGCCCGGAAGG + Intronic
1121517704 14:94563771-94563793 AGCCGCAGCCAGATCCTTGAGGG + Exonic
1121777327 14:96599190-96599212 CTCTGAAGGCAGAGCCAAGAGGG + Intergenic
1121794579 14:96724451-96724473 TTCCACAGGCAGAGGGTTGAAGG - Intergenic
1122435293 14:101691200-101691222 CTCCCCTGGCAGAGCCTTGCAGG - Intergenic
1122552727 14:102558765-102558787 CTCAACAGGCAGGGCCCTGAGGG - Intergenic
1122605296 14:102944106-102944128 CTCAGCAGGCAGAACCCAGAAGG + Exonic
1122744381 14:103889330-103889352 CTCCTGGGGCAGAGCATTGAGGG - Intergenic
1122930643 14:104931707-104931729 CTGGGCTGGCAGAGCCTTCAGGG + Intronic
1123984133 15:25630125-25630147 CTCCGGAGTCAGAGCCTACATGG + Intergenic
1124945567 15:34262514-34262536 CTCCACTGGCAGAGCGTGGAGGG - Intronic
1125590705 15:40853143-40853165 CTGGGCAGGCATAGACTTGAAGG + Exonic
1125957077 15:43797882-43797904 CTCCCCAGGAAAAGCCTTTAGGG + Exonic
1126257164 15:46641573-46641595 CTCAGCAAGCAGAAGCTTGAAGG - Intergenic
1126815277 15:52447945-52447967 CTGCAGAGGCAGAGCCTTCATGG + Intronic
1128645467 15:69375581-69375603 CTCCCCAGGCGGAGCAATGAAGG + Intronic
1130424014 15:83776969-83776991 CACTGCAGACAGAGCCTTGGTGG + Intronic
1130722803 15:86405997-86406019 CACAGCAGGCACAGCCTAGAGGG + Intronic
1131149280 15:90036829-90036851 CGAGGCAGACAGAGCCTTGAAGG - Intronic
1132519843 16:381996-382018 CCCCGCAGGCCGAGCCGGGAAGG + Intronic
1132804562 16:1769545-1769567 CTGCCCAGGCAGAGCCTGGGGGG - Exonic
1133130965 16:3675914-3675936 GTGCACAGGCAGAGCCGTGAAGG - Intronic
1133293455 16:4737744-4737766 GGCAGCAGGCAGAGCCCTGAGGG - Intronic
1133779241 16:8924456-8924478 CTCTACAGGCAGTGCCTGGAAGG + Intronic
1134191211 16:12122482-12122504 CTCCCCAAGCAGAAGCTTGAAGG + Intronic
1135984263 16:27172592-27172614 CTCCACAAGCAGAGTCTTGAGGG + Intergenic
1140225074 16:73070618-73070640 CTCGGCAGGCACTGCCTTTATGG + Intergenic
1141407437 16:83807008-83807030 CTCCATAGACAGAGCCCTGAGGG - Intergenic
1141771269 16:86090970-86090992 CTCCTCAGCCAGAGCATTCATGG + Intergenic
1142432703 16:90038874-90038896 CACCACAGACAAAGCCTTGAGGG - Intronic
1144126377 17:12206674-12206696 CTCCGAAGGCAGAGCCTTTGTGG + Intergenic
1144641571 17:16940062-16940084 CTCCAGATGCAGAGCCTTCAGGG - Intronic
1147950552 17:44105311-44105333 CTCGGGATGCAGAGCCCTGATGG + Intronic
1148446611 17:47741724-47741746 CTCCACAGGCAGTTCCTGGAAGG - Intronic
1151875519 17:76865964-76865986 GTCCTCAGGCAGAGAGTTGAAGG + Intergenic
1152398448 17:80049470-80049492 CTTCGCAGCCACTGCCTTGAGGG + Intronic
1152463683 17:80454374-80454396 GTTCTCAGGCAGAGCCTTGGCGG - Intergenic
1153094319 18:1383413-1383435 CTTTGCAGACAGAGCCTTGATGG + Intergenic
1157186996 18:45549220-45549242 CACCGAAGGCAGAGCATTGATGG - Intronic
1160998168 19:1894604-1894626 CTTCGCAGGCAGAGGCCTCAGGG + Intergenic
1162179274 19:8856201-8856223 TTCTGCAGGAAGAGCCTAGAAGG - Intronic
1164629924 19:29755249-29755271 CTCCACAGGCAGAGGCAGGAGGG + Intergenic
1166364195 19:42270238-42270260 CCTCACAGGCAGAGCCTGGAGGG - Intronic
1167340230 19:48911266-48911288 GTCCGGAGGCAGAGGATTGAGGG + Intronic
925785939 2:7431426-7431448 CTCCGCCCGCAGAGCCTTCCGGG + Intergenic
926116888 2:10218983-10219005 CCCTGCAGGCAGAGCCCTCATGG - Intergenic
927198020 2:20561267-20561289 CACTGCATGCAGAGCCCTGAGGG + Intronic
927938008 2:27086242-27086264 CTCCGCAGGCCGGCCCTGGAGGG - Exonic
928619069 2:33070715-33070737 CTGTGCAGGCAGCTCCTTGAAGG + Intronic
928911971 2:36430771-36430793 CTCACCAGGGAGAGCCTTTATGG + Intronic
931278068 2:60762135-60762157 CACAGCAGGAAGAGGCTTGAAGG + Intronic
935055468 2:99562912-99562934 CTCCGCAGGCAGTACCATCAGGG - Intronic
936721292 2:115255091-115255113 CTGCACAGACAGAGCCTTCATGG - Intronic
937226945 2:120375542-120375564 CTCAACTGGCAGAGCCTTGGGGG + Intergenic
946224865 2:218259071-218259093 TTCCTCAGGCAGAGCCTGAATGG - Intergenic
948038112 2:234875807-234875829 CTAGGCAGGCAGAGGCTTGGTGG - Intergenic
1172308139 20:33896405-33896427 CCACGCAGGCAGAGCCCTCATGG - Intergenic
1174276880 20:49410289-49410311 CTAATCAGGCAGAGCTTTGAAGG + Intronic
1175321950 20:58094487-58094509 CTCCCCAGCCACAGCCTAGAAGG + Intergenic
1175686246 20:61030817-61030839 CTCTCCAGCCAGAGCCTTGGAGG + Intergenic
1179878767 21:44284885-44284907 CCCCGCAGGCATGGCCTGGAGGG - Intergenic
1183463663 22:37968258-37968280 CTCCCCAGGCAGAGCCCTGCTGG + Exonic
1184145785 22:42609503-42609525 CTCCCCAGACAGAGCCAGGAGGG - Intronic
1185037812 22:48489100-48489122 CACCGCAGCCAGGGCCTGGAAGG - Intergenic
1185318368 22:50188889-50188911 CACCTCAGGCAGAGCCCTAACGG + Intronic
950026734 3:9825386-9825408 CTTCCCTGGCAGGGCCTTGAGGG + Intronic
950621975 3:14213055-14213077 CTCCGAAGGCTGAGCCTTTAAGG - Intergenic
954414784 3:50387897-50387919 CTCTGCAGACAGAACCTAGAAGG - Intronic
956921086 3:73930203-73930225 ATCTGCAGGTAGAGCCTTTAAGG + Intergenic
959421626 3:106135856-106135878 CACTGCAGTCAGAGCCTTGGCGG + Intergenic
960940525 3:122930130-122930152 CTCTGCAGGCAGTGACTTCATGG - Intronic
961076357 3:123986618-123986640 CACTGCAGACAGAGCCTTGGAGG - Intronic
961432580 3:126893659-126893681 CTCCCCAGGTAGAGCCCTGCTGG - Intronic
964170847 3:153768176-153768198 CCACGCAGGCAGAGCAATGAAGG - Intergenic
965486424 3:169284131-169284153 CTCCTTGGGCAGAGTCTTGATGG - Intronic
965604347 3:170484323-170484345 CCCCGTAGGCAGAGTGTTGAAGG - Intronic
966927829 3:184657056-184657078 CTCCCCACGCAGGGCCTAGAAGG - Intronic
969251711 4:5972696-5972718 CCCCACAGGCAGAGCCTGGAGGG + Intronic
969543861 4:7811243-7811265 CTCCGCAGCCAGCGGGTTGAGGG - Intronic
970099346 4:12503055-12503077 CTTCAGAGGCAGAGCCTTCATGG - Intergenic
970542737 4:17095907-17095929 CTCCACAGGGGGAGCCTGGATGG - Intergenic
971200843 4:24507973-24507995 CTCCCCAGGCTGAGACTTGATGG - Intergenic
972189634 4:36574599-36574621 CTGCCTGGGCAGAGCCTTGAGGG - Intergenic
979158560 4:117429473-117429495 CACTGCAGACAGAGCCTTGGAGG - Intergenic
979918235 4:126466540-126466562 CTCCAAAGGCATAGCCTTGGAGG - Intergenic
982355641 4:154464837-154464859 CTCCTCAGGAACAGCCTTTAGGG - Intronic
985583396 5:712210-712232 CTCTACAGGCAGGACCTTGATGG + Exonic
985596909 5:796508-796530 CTCTACAGGCAGGACCTTGATGG + Exonic
988490365 5:31700558-31700580 CTTAGCAGGCAGGGCCTTGCAGG - Intronic
996568707 5:124909429-124909451 CTTCAAAGGCAGAGCCTGGATGG + Intergenic
998148919 5:139746165-139746187 CTCCCCAGGCCAAGCTTTGAGGG - Intergenic
1001550310 5:172598019-172598041 TTCCGCAGCCACAGCCTTCATGG + Intergenic
1010888415 6:81272693-81272715 CTACGCTGGCAGAGACTGGATGG + Intergenic
1011723295 6:90181902-90181924 CTCTGCAGTCTGAGCCCTGAAGG + Intronic
1015495178 6:133874462-133874484 CTTCCCAGGCATAGCCTTGGTGG - Intergenic
1019334759 7:477892-477914 CTCCGCAGGCAGATGCTACAGGG + Intergenic
1019647965 7:2141141-2141163 CTCCCCAGGCAGAGCCCGCAAGG - Intronic
1020333941 7:7047103-7047125 CTGAGCAGCCAGAGCCTAGAAGG + Intergenic
1022036068 7:26535917-26535939 CTCTGCTGGCAGAGCCATCAGGG + Exonic
1024520041 7:50297536-50297558 CTCCGCAGTCAGTTCCTTGAAGG - Intergenic
1025014529 7:55428187-55428209 AGCCGCAAGCAGAGCCTTGCTGG + Intronic
1025845099 7:65189052-65189074 CTCCTGCAGCAGAGCCTTGAAGG + Intergenic
1026846107 7:73699990-73700012 CCCCACAAGCAGAGCCCTGAGGG - Exonic
1028605174 7:92647480-92647502 CTCTGCAGGCAGTTTCTTGAAGG + Intronic
1032054851 7:128675852-128675874 CTCAGCAGGTAAAGGCTTGAGGG + Exonic
1032838817 7:135697938-135697960 CTCTGCAGGGAGAGCCCTGCTGG - Intronic
1033735171 7:144214977-144214999 CTCCAGGGGCAGAGCCTTCATGG + Intergenic
1033747885 7:144335992-144336014 CTCCAGGGGCAGAGCCTTCATGG - Intergenic
1037891026 8:22623782-22623804 CACCCCAGGCAAAGCCCTGAAGG - Intronic
1038291817 8:26256583-26256605 CTCCGAAGGCAGTGGCTTGAAGG + Intergenic
1039075788 8:33689510-33689532 GTCCACAGGCACAGGCTTGAGGG - Intergenic
1039839192 8:41281326-41281348 CTCCACTGGCAAATCCTTGAAGG - Intronic
1041922224 8:63195060-63195082 CTCCACAGGAAGAGCCTTGTTGG - Intronic
1042827187 8:72991235-72991257 CTGCACAGGCAGAGCCCTCATGG + Intergenic
1042845338 8:73164300-73164322 CTAGGCGGGCAGAGCCTTTAAGG + Intergenic
1049385479 8:142341026-142341048 CTCTGCAGTTAGGGCCTTGAGGG - Intronic
1050452820 9:5801790-5801812 GTCCACTGGCAGAGTCTTGAAGG - Intronic
1051186891 9:14469772-14469794 CTCCCCAGGCAGAACCATGATGG - Intergenic
1053451934 9:38200985-38201007 CTGAGCAGGGAGAACCTTGAAGG - Intergenic
1055177897 9:73343007-73343029 CACCGCAGGCAGAGCCCTGGAGG - Intergenic
1057854861 9:98594325-98594347 CTGCGCAGGCAGTGTCGTGATGG - Intronic
1059433301 9:114262510-114262532 CTCCCCTGGCAGAGCCTGGCAGG + Intronic
1062047584 9:134431646-134431668 CCCCGCAGGCAGACCCTAGAGGG + Intronic
1062200378 9:135299780-135299802 CTCCCCAGGCAGAGCCCACATGG + Intergenic
1190740278 X:53284040-53284062 CCCAGCATGCAGAGCCTTGGAGG + Intronic
1191710795 X:64148494-64148516 CTCCACAGCCTGAGCCTTCATGG + Intergenic
1191823645 X:65340003-65340025 CATTGCAGTCAGAGCCTTGATGG + Intergenic
1193497957 X:82237437-82237459 CTCCATGGGCAGAGCCCTGAGGG - Intergenic
1193593545 X:83419394-83419416 CATTGCAGGCAGAGCCTTGACGG + Intergenic
1194781314 X:98028531-98028553 CACTGCAGACAGAGCCTTGGCGG - Intergenic
1195904275 X:109828689-109828711 CTCACCAGGAAGAGCCTTAATGG - Intergenic
1197147302 X:123184702-123184724 CACCGCAGGGAAAGCCTTGCCGG - Intronic
1198024674 X:132693466-132693488 CTCAGAGGGCAGAGCCTGGAAGG + Intronic
1199249030 X:145638181-145638203 CTCCCCAGACAGAGCCTCCAGGG + Intergenic