ID: 1077777294

View in Genome Browser
Species Human (GRCh38)
Location 11:5285597-5285619
Sequence ATGCTAGGAGGGCCTCTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1323
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 1304}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077777287_1077777294 24 Left 1077777287 11:5285550-5285572 CCAGGTTGTCCAACGCTGAAAGT 0: 1
1: 0
2: 1
3: 4
4: 61
Right 1077777294 11:5285597-5285619 ATGCTAGGAGGGCCTCTGCATGG 0: 1
1: 0
2: 1
3: 17
4: 1304
1077777289_1077777294 15 Left 1077777289 11:5285559-5285581 CCAACGCTGAAAGTAGGAATCTA 0: 1
1: 0
2: 1
3: 9
4: 135
Right 1077777294 11:5285597-5285619 ATGCTAGGAGGGCCTCTGCATGG 0: 1
1: 0
2: 1
3: 17
4: 1304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077777294 Original CRISPR ATGCTAGGAGGGCCTCTGCA TGG Intronic
900548457 1:3241667-3241689 AGGCAAGAAGGGCCTCCGCATGG + Intronic
901175538 1:7296100-7296122 ATGCCATGTGGGCCTCTCCATGG + Intronic
901270953 1:7952733-7952755 ATGTGAGGAGCGCCTCTGCTGGG + Intergenic
901341224 1:8500874-8500896 ATGTGAGGAGCGCCTCTGCCTGG + Intronic
901555566 1:10028966-10028988 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
901734859 1:11305953-11305975 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
901855768 1:12043298-12043320 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
902018626 1:13328299-13328321 ATGTGAGGAGCGCCTCTGCTGGG + Intergenic
903081320 1:20815445-20815467 ATGTGAGGAGCGCCTCTGCTGGG + Intronic
903100326 1:21023922-21023944 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
903485829 1:23688852-23688874 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
903508132 1:23853140-23853162 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
903519393 1:23935646-23935668 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
903526410 1:23994638-23994660 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
903633889 1:24799312-24799334 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
903638010 1:24834155-24834177 ATGTGAGGAGCGCCTCTGCTGGG - Intronic
903894724 1:26596141-26596163 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
903923507 1:26817774-26817796 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
903962081 1:27064074-27064096 ATGTGAGGAGCGCCTCTGCTGGG + Intergenic
903993391 1:27289393-27289415 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
904585071 1:31575791-31575813 CAGGAAGGAGGGCCTCTGCAGGG + Intergenic
904794909 1:33051644-33051666 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
904831688 1:33309675-33309697 ATGTGAGGAGTGCCTCTGCCTGG - Intronic
904857368 1:33509519-33509541 ATGTGAGGAGTGCCTCTGCCCGG - Intergenic
905039989 1:34948014-34948036 ATGTGAGGAGGCCCTCTGCCCGG + Intergenic
905653822 1:39673102-39673124 TAGCTAGGAGGGCCTCTGACTGG + Intergenic
905699300 1:39999707-39999729 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
906329921 1:44876369-44876391 ATGTGAGGAGCGCCTCTGCCTGG + Intronic
906355834 1:45105802-45105824 ATGTGAGGAGAGCCTCTGCCCGG + Intronic
906355908 1:45106064-45106086 AGGTGAGGAGCGCCTCTGCACGG + Intronic
906357011 1:45115509-45115531 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
906427169 1:45724643-45724665 ATGTGAGGAGCGCCTCTGCCGGG + Intronic
906486740 1:46240805-46240827 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
906741927 1:48192405-48192427 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
906761943 1:48383670-48383692 ATGTGAGGAGCGCCTCTGCTGGG - Intronic
906770583 1:48479362-48479384 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
906998654 1:50826998-50827020 ATGTGAGGAGTGCCTCTGCCCGG + Intronic
907089667 1:51711744-51711766 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
907140541 1:52181747-52181769 ATGTGAGGAGCGCCTCTGCCTGG + Intronic
907216649 1:52870076-52870098 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
907402421 1:54233244-54233266 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
907402432 1:54233284-54233306 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
907453833 1:54562738-54562760 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
907480313 1:54741314-54741336 ATGCAAGGTGAGCCTCTGGATGG - Intronic
908467842 1:64414952-64414974 ATGTGAGGAGCGCCTCTGCCTGG + Intergenic
909623137 1:77687638-77687660 AAGTGAGGAGGGCCTCTGCCCGG + Intergenic
909623152 1:77687698-77687720 AAGTGAGGAGGGCCTCTGCCCGG + Intergenic
909641164 1:77870415-77870437 ATGTGAGGAGCGCCTCTGCTGGG - Intronic
910343745 1:86215766-86215788 ATGTGAGGAGCGCCTCTGCCTGG + Intergenic
910406985 1:86899919-86899941 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
910412752 1:86964046-86964068 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
910891687 1:92026257-92026279 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
911569852 1:99508631-99508653 ATGTGAGGAGTGCCTCTGCCCGG + Intergenic
911569914 1:99508858-99508880 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
911598551 1:99823579-99823601 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
911602072 1:99857183-99857205 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
912266180 1:108160208-108160230 ATGTGAGGAGCGCCTCTGCTCGG - Intronic
912298555 1:108490161-108490183 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
912316943 1:108675694-108675716 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
912355736 1:109053272-109053294 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
912358362 1:109073874-109073896 ATGTGAGGAGCGCCTCTGCTCGG + Intronic
912751662 1:112293243-112293265 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
912825396 1:112898988-112899010 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
912844067 1:113063749-113063771 ATGTGAGGAGTGCCTCTGCCCGG - Intergenic
912844748 1:113069117-113069139 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
912966636 1:114242449-114242471 ATGTGAGGAGTGCCTCTGCCCGG + Intergenic
912966776 1:114242871-114242893 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
912966830 1:114243056-114243078 AGGTGAGGAGCGCCTCTGCACGG + Intergenic
913022840 1:114804702-114804724 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
913078374 1:115360224-115360246 AGGTCAGGAGTGCCTCTGCACGG - Intergenic
913078569 1:115360923-115360945 ATGTGAGGAGCGCCTCTGCCTGG - Intergenic
913306251 1:117430541-117430563 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
913993732 1:143637737-143637759 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
914230922 1:145764461-145764483 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
914392147 1:147233123-147233145 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
914775308 1:150729318-150729340 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
914780588 1:150781649-150781671 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
914887978 1:151600254-151600276 ATGTGAGGAGCGCCTCTGCTGGG + Intergenic
914909046 1:151769599-151769621 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
914947361 1:152079209-152079231 AAGTTAGGAGAGCCTCTGCCCGG - Intergenic
914965843 1:152256494-152256516 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
914987375 1:152472225-152472247 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
915221634 1:154379639-154379661 AAGTAAGGAGGGCCTCTGCCTGG - Intergenic
915221741 1:154380112-154380134 ATGTGAGGAGTGCCTCTGCCTGG - Intergenic
915539164 1:156556996-156557018 ATGTGAGGAGTGCCTCTGCCCGG + Intronic
916087521 1:161281758-161281780 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
916221754 1:162451483-162451505 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
916221794 1:162451633-162451655 ATGTGAGGAGCGCCTCTGCCTGG - Intergenic
917006153 1:170418917-170418939 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
917376128 1:174350422-174350444 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
917848453 1:179040946-179040968 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
917889166 1:179418948-179418970 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
918172448 1:182010850-182010872 ATGTGAGGAGCGCCTCTGCCTGG + Intergenic
918228813 1:182510010-182510032 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
918701623 1:187615765-187615787 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
918701767 1:187616296-187616318 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
918701820 1:187616490-187616512 ATGTGAGGAGTGCCTCTGCCCGG + Intergenic
918702007 1:187617127-187617149 ATGTGAGGAGCGCCTCTGCCTGG + Intergenic
919959476 1:202452037-202452059 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
920382730 1:205545018-205545040 ATGTGAGGAGTGCCTCTGCCTGG - Intergenic
920794903 1:209129102-209129124 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
921007930 1:211112333-211112355 AAGCGAGGAGTGCCTCTGCTTGG + Intronic
921127470 1:212190249-212190271 AAGCGAGGAGCGCCTCTGCCTGG + Intergenic
921127480 1:212190289-212190311 AAGCGAGGAGCGCCTCTGCCTGG + Intergenic
921192759 1:212724869-212724891 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
921487152 1:215728370-215728392 ATGCCAGCAGGGCGTCTGAAAGG + Exonic
921814026 1:219545667-219545689 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
921902810 1:220466850-220466872 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
922102431 1:222487663-222487685 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
922306556 1:224350036-224350058 ATGTGAGGAGCGCCTCTGCCTGG - Intergenic
922458430 1:225796283-225796305 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
922458450 1:225796357-225796379 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
922632779 1:227132795-227132817 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
922644859 1:227276226-227276248 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
923267912 1:232331733-232331755 ATGTGAGGAGCGCCTCTGCCTGG + Intergenic
923468285 1:234267826-234267848 ATGTGAGGAGCGCCTCTGCTGGG - Intronic
923589853 1:235309139-235309161 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
923710751 1:236386577-236386599 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
924765956 1:247032229-247032251 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
924824108 1:247522004-247522026 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1063776823 10:9273547-9273569 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1064013831 10:11757952-11757974 ATACTCGGTGGGCCTGTGCATGG - Intronic
1064108694 10:12520262-12520284 ATGTGAGGAGCGCCTCTGCTGGG - Intronic
1064663637 10:17629450-17629472 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1064717655 10:18193532-18193554 ATTCCAGAAGGGCCTCTGCAGGG + Intronic
1065335781 10:24655878-24655900 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1065366942 10:24945941-24945963 ATTCTAGGAGAGCCTCTGGCAGG + Intronic
1065594442 10:27296825-27296847 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1066026056 10:31361846-31361868 AAGCGAGGAGTGCCTCTGCCCGG - Intronic
1066026075 10:31361926-31361948 AAGCGAGGAGTGCCTCTGCCCGG - Intronic
1066026184 10:31362371-31362393 AAGCGAGGAGTGCCTCTGCCCGG - Intronic
1066026196 10:31362411-31362433 AAGCGAGGAGTGCCTCTGCCCGG - Intronic
1066085292 10:31969745-31969767 ATGTGAGGAGCGCCTCTGCTGGG + Intergenic
1066141152 10:32505769-32505791 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1066141281 10:32506263-32506285 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1066390884 10:34976580-34976602 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1067034129 10:42900401-42900423 ATGTGAGGAGTGCCTCTGCCCGG + Intergenic
1067117470 10:43446565-43446587 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1067120099 10:43465519-43465541 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1067333934 10:45346650-45346672 ATGTGAGGAGGGCTTCTGCCCGG + Intergenic
1067334215 10:45347679-45347701 AAGCGAGGAGTGCCTCTGCCTGG + Intergenic
1067334225 10:45347716-45347738 AAGCGAGGAGTGCCTCTGCCCGG + Intergenic
1067334459 10:45348557-45348579 AGGCGAGGAGCGCCTCTGCCTGG + Intergenic
1067391270 10:45865735-45865757 ATGTGAGGAGCGCCTCTGCCTGG - Intergenic
1067872018 10:49970417-49970439 ATGTGAGGAGCGCCTCTGCCTGG + Intronic
1068006062 10:51393192-51393214 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1068536226 10:58243955-58243977 ATGTGAGGAGTGCCTCTGCCTGG + Intronic
1068969551 10:62947609-62947631 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1069052729 10:63811795-63811817 ATGTGAGGAGCGCCTCTGCCTGG - Intergenic
1069424798 10:68279514-68279536 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1069645479 10:69993203-69993225 ATGTGAGGAGCGCCTCTGCTGGG - Intergenic
1069674566 10:70238654-70238676 AGGTGAGGAGCGCCTCTGCATGG - Intergenic
1069674626 10:70238844-70238866 ATGTGAGGAGTGCCTCTGCCCGG - Intergenic
1069674858 10:70239681-70239703 ATGTGAGGAGTGCCTCTGCCCGG - Intergenic
1069674922 10:70239911-70239933 ATGTGAGGAGTGCCTCTGCCCGG - Intergenic
1069697660 10:70398847-70398869 AGACTAGGAGGCCCTCTACATGG - Intergenic
1069732947 10:70631090-70631112 ATGTAAGGAGCGCCTCTGCCCGG + Intergenic
1069741485 10:70688199-70688221 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1070318165 10:75333869-75333891 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1070367397 10:75750449-75750471 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1070367448 10:75750608-75750630 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1071538248 10:86454704-86454726 ATGTGAGGAGGCCCTCTGCCCGG + Intronic
1071616432 10:87080602-87080624 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1071840992 10:89470830-89470852 ATACTAGGAAAACCTCTGCATGG + Intronic
1072116493 10:92374859-92374881 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1072150085 10:92675657-92675679 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1072481129 10:95810183-95810205 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1072602428 10:96941773-96941795 ATGTGAGGAGCGCCTCTGCTGGG - Intronic
1072648159 10:97275407-97275429 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1072772380 10:98152654-98152676 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1072950038 10:99839797-99839819 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1072956451 10:99891837-99891859 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1072980140 10:100092844-100092866 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1073274885 10:102301636-102301658 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1073386019 10:103128730-103128752 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1073446265 10:103582340-103582362 AGGCCAGGAGGGCCTGTGCAGGG - Intronic
1075051025 10:119182531-119182553 ATGTGAGGAGTGCCTCTGCCCGG - Intergenic
1075061696 10:119261269-119261291 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1075108616 10:119559959-119559981 ATGCGAGGAGCCCCTCTGCCCGG - Intergenic
1075181472 10:120215374-120215396 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1075428575 10:122362305-122362327 ATGCTAGGAGGGAGGCAGCAAGG - Intergenic
1075842756 10:125518393-125518415 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1077300342 11:1843850-1843872 ATTCTAGAAAGGCCTCAGCAGGG + Intergenic
1077397509 11:2332411-2332433 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1077573185 11:3356364-3356386 ATTTTTGGAGGGCCTCTGTAAGG + Intronic
1077662365 11:4081079-4081101 AGGCCAGGAGGGCCTCAGCTAGG - Intronic
1077777294 11:5285597-5285619 ATGCTAGGAGGGCCTCTGCATGG + Intronic
1077992063 11:7420917-7420939 GTACTTGGAGGGCATCTGCAAGG + Intronic
1078176851 11:8978037-8978059 ATGTGAGGAGCGCCTCTGCTGGG + Intergenic
1079018301 11:16888017-16888039 ATGTGAGGAGCGCCTCTGCCTGG + Intronic
1079173849 11:18120930-18120952 ATGTTAGGAGCCCCTCTGCCTGG + Intronic
1079173897 11:18121123-18121145 ATGTGAGGAGCGCCTCTGCCCGG + Exonic
1079444799 11:20548411-20548433 ATGTGAGGAGCGCCTCTGCTGGG + Intergenic
1080097903 11:28430021-28430043 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1080368743 11:31609464-31609486 ATTTTTGGAGGGCCTCTGTAAGG + Intronic
1080830576 11:35890152-35890174 ATGCTGTGAGGGCCTCTGGGTGG + Intergenic
1080983088 11:37431248-37431270 AAGCGAGGAGTGCCTCTGCCTGG - Intergenic
1080983099 11:37431285-37431307 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1080983170 11:37431547-37431569 ATGTGAGGAGCGCCTCTGCCTGG - Intergenic
1080983207 11:37431700-37431722 AAGCAAGGAGCGCCTCTGCCCGG - Intergenic
1081288632 11:41303751-41303773 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1081568865 11:44277257-44277279 ATGCTTGGAGGACTTCTCCAGGG - Intronic
1081784868 11:45738846-45738868 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1082233785 11:49798577-49798599 ATGTGAGGAGCGCCTCTGCCTGG - Intergenic
1082844825 11:57717034-57717056 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1082871033 11:57944005-57944027 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1083030211 11:59585300-59585322 ATGAGAGGAGCGCCTCTGCCCGG + Intronic
1083382254 11:62278584-62278606 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1083646234 11:64172789-64172811 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1083832012 11:65239282-65239304 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1083918035 11:65763011-65763033 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1084388777 11:68861514-68861536 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1084624486 11:70296013-70296035 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1084624529 11:70296206-70296228 ATGTTAGGAGCCCCTCTGCCTGG - Intronic
1084640038 11:70420231-70420253 CTCCAAGGAGGGCCTCTTCATGG + Intronic
1084645835 11:70457094-70457116 AGGTGAGGAGCGCCTCTGCATGG - Intergenic
1084989498 11:72909699-72909721 ATGTGAGGAGCGCCTCTGCCTGG + Intronic
1084989639 11:72910234-72910256 ATGTGAGGAGAGCCTCTGCCCGG + Intronic
1085097773 11:73775045-73775067 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1085139720 11:74129406-74129428 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1085290392 11:75394999-75395021 ACGCTCAGAGGGCCCCTGCATGG + Intergenic
1085292526 11:75410320-75410342 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1085360159 11:75878192-75878214 ATGTAAGGAGCGCCTCTGCCCGG - Intronic
1085443374 11:76582678-76582700 ATGTGAGGAGTGCCTCTGCCCGG - Intergenic
1085480834 11:76821434-76821456 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1085513420 11:77099061-77099083 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1085716674 11:78879324-78879346 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1085716804 11:78879783-78879805 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1086104426 11:83133253-83133275 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1086366043 11:86110603-86110625 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1086430496 11:86732229-86732251 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1086434869 11:86770876-86770898 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1086490514 11:87354071-87354093 AGGCTAGGAAGGCTTCTGCCTGG + Intergenic
1087057405 11:93947578-93947600 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1087198356 11:95321406-95321428 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1087487032 11:98770166-98770188 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1087948508 11:104194275-104194297 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1088257093 11:107912468-107912490 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1088677191 11:112206088-112206110 ATGTGAGGAGCGCCTCTGCCTGG - Intronic
1088677213 11:112206167-112206189 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1089350808 11:117820641-117820663 ATGCTAGGAGGGCCTGGGGAAGG - Intronic
1089510190 11:118991889-118991911 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1089585678 11:119508214-119508236 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1089709073 11:120302126-120302148 GTGCTAGGAGGGCCTCTCCATGG + Intronic
1089789323 11:120931258-120931280 TTATTAGGAGGGCCCCTGCAGGG + Intronic
1090152815 11:124403484-124403506 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1090322869 11:125862872-125862894 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1090791201 11:130092053-130092075 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1090906924 11:131084477-131084499 ATGTGAGGAGCGCCTCTGCTGGG - Intergenic
1091378542 12:41919-41941 ATGTGAGGAGCGCCTCTGCTGGG + Intergenic
1091400957 12:180285-180307 ATTCAAGGAAGGCCTCTCCAAGG + Intergenic
1091912946 12:4246368-4246390 CTGACAGCAGGGCCTCTGCAAGG + Intergenic
1092296071 12:7200221-7200243 ATGTGAGGAGCGCCTCTGCCTGG - Intronic
1092453543 12:8625100-8625122 ATGTGAGGAGCGCCTCTGCTGGG + Intergenic
1092590931 12:9952839-9952861 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1093038482 12:14354697-14354719 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1094087393 12:26608621-26608643 AAGAGAGGAGGGCCTCTGCCTGG + Intronic
1094103221 12:26784967-26784989 ATGTGAGGAGCGCCTCTGCTGGG + Intronic
1094319685 12:29171465-29171487 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1094473368 12:30823286-30823308 AAGGCAAGAGGGCCTCTGCAGGG + Intergenic
1094717001 12:33023039-33023061 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1095571043 12:43685034-43685056 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1095774849 12:46000241-46000263 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1095774860 12:46000278-46000300 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1095774871 12:46000315-46000337 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1095774882 12:46000352-46000374 ATGTGAGGAGCGCCTCTGCCTGG + Intergenic
1096022399 12:48333435-48333457 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1096039453 12:48500841-48500863 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1096044625 12:48551862-48551884 ATGTGAGGAGTGCCTCTGCCTGG + Intergenic
1096054857 12:48642294-48642316 ATGTGAGGAGTGCCTCTGCCTGG + Intergenic
1096063929 12:48724690-48724712 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1096093044 12:48915931-48915953 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1096224939 12:49860893-49860915 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1096856705 12:54488614-54488636 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1096951657 12:55479408-55479430 ATGCGAGGAGCGCCTCTGCCCGG - Intergenic
1097228652 12:57495372-57495394 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1097230577 12:57507992-57508014 ATGTAAGGAGCGCCTCTGCCCGG - Intronic
1097254749 12:57665055-57665077 ATGTGAGGAGCGCCTCTGCCTGG + Intergenic
1097254873 12:57665515-57665537 ATGTGAGGAGAGCCTCTGCCTGG + Intergenic
1097626908 12:62011117-62011139 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1098018921 12:66134586-66134608 ATGTGAGGAGTGCCTCTGCCCGG + Intronic
1098023125 12:66175077-66175099 AGGTGAGGAGGGCCTCTGCCCGG + Intergenic
1098375164 12:69807243-69807265 AGGTGAGGAGCGCCTCTGCACGG - Intronic
1098412574 12:70201792-70201814 ATGTGAGGAGCGCCTCTGCTGGG + Intergenic
1098773926 12:74588344-74588366 ATGTGAGGAGCGCCTCTGCCTGG - Intergenic
1098783739 12:74722652-74722674 ATGCTAGAAGCTCATCTGCAAGG + Intergenic
1100353621 12:93808342-93808364 AGGCAAGGAGAGCCTGTGCAGGG + Intronic
1100570788 12:95841710-95841732 ATGTGAGGAGCGCCTCTGCTGGG - Intergenic
1100581981 12:95947279-95947301 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1100995286 12:100295029-100295051 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1101170641 12:102089328-102089350 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1101170652 12:102089368-102089390 ATGTGAGGAGTGCCTCTGCCCGG - Intronic
1101516652 12:105442345-105442367 ATGCCATGAAGGCCACTGCAGGG + Intergenic
1101885155 12:108656004-108656026 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1102268261 12:111507288-111507310 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1102294202 12:111723918-111723940 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1102578474 12:113872189-113872211 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1103234562 12:119360583-119360605 ATGTGAGGAGTGCCTCTGCCCGG - Intronic
1103299921 12:119919067-119919089 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1103414109 12:120732593-120732615 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1103591229 12:121993631-121993653 ATGTGAGGAGTGCCTCTGCCCGG + Intronic
1104712899 12:130997535-130997557 ATGTGAGGAGCGCCTCTGCTCGG - Intronic
1104861467 12:131926475-131926497 ATGCGAGGAGCGTCTCTGCCCGG - Intergenic
1105248453 13:18673868-18673890 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1105295888 13:19087720-19087742 GTGCAGGGAGGGCCTCAGCAAGG - Intergenic
1105367660 13:19779035-19779057 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1105555920 13:21447946-21447968 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1105927471 13:25020022-25020044 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1105976850 13:25480487-25480509 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1106680095 13:32000071-32000093 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1106918543 13:34540496-34540518 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1107165795 13:37280277-37280299 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1107692439 13:42966447-42966469 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1107737708 13:43416431-43416453 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1107863547 13:44682730-44682752 ATGTGAGGAGCGCCTCTGCCTGG - Intergenic
1107953387 13:45485643-45485665 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1108024371 13:46162808-46162830 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1108330190 13:49378017-49378039 ATGTGAGGAGTGCCTCTGCCCGG + Intronic
1108351285 13:49592805-49592827 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1108501929 13:51077814-51077836 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1109266404 13:60205657-60205679 ATGTGAGGAGTGCCTCTGCCTGG + Intergenic
1109266422 13:60205737-60205759 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1110269265 13:73574608-73574630 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1110626549 13:77660988-77661010 AAGCGAGGAGTGCCTCTGCCTGG - Intergenic
1111418394 13:87976872-87976894 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1111418437 13:87977065-87977087 ATGTTAGGAGCCCCTCTGCCTGG - Intergenic
1113193919 13:107782524-107782546 ATGTTAGGAGCCCCTCTGCCTGG + Intronic
1113193966 13:107782717-107782739 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1113329097 13:109311522-109311544 ATGTGAGGAGTGCCTCTGCCCGG + Intergenic
1113937050 13:114000071-114000093 CTGCCAGGAGGGTCTCTGCTGGG + Intronic
1113937061 13:114000115-114000137 CTGCCAGGAGGGTCTCTGCTGGG + Intronic
1113965607 13:114151595-114151617 ATTCTAGGGGGGCAACTGCACGG + Intergenic
1114199069 14:20505978-20506000 ATGTGAGGAGCGCCTCTGCTGGG + Intronic
1114280472 14:21188843-21188865 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1114428193 14:22638987-22639009 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1114507861 14:23232267-23232289 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1114510816 14:23258836-23258858 AAGTGAGGAGGGCCTCTGGAGGG - Intronic
1115324929 14:32128054-32128076 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1115493962 14:33984575-33984597 ATGTGAGGAGTGCCTCTGCCCGG - Intronic
1115504247 14:34078901-34078923 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1115547424 14:34476085-34476107 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1115609636 14:35038874-35038896 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1115622358 14:35152762-35152784 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1115622396 14:35152915-35152937 ATGCGAGGAGCCCCTCTGCCCGG - Intronic
1115703777 14:35977967-35977989 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1116409069 14:44601325-44601347 AAGCGAGGAGCGCCTCTGCCCGG + Intergenic
1116480303 14:45389023-45389045 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1116871727 14:50074289-50074311 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1117596816 14:57333598-57333620 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1117763689 14:59058998-59059020 ATGTGAGGAGTGCCTCTGCCCGG - Intergenic
1118209379 14:63751429-63751451 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1118239012 14:64038133-64038155 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1118253306 14:64183287-64183309 ATGGGAGGAGCGCCTCTGCCCGG - Intronic
1118341283 14:64896015-64896037 ATGTGAGGAGCGCCTCTGCTGGG - Intergenic
1118418708 14:65575124-65575146 AGTCTAGGAGTGCCTCTGGACGG + Intronic
1118423511 14:65633644-65633666 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1118428651 14:65692838-65692860 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1118430871 14:65717529-65717551 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1119137758 14:72236642-72236664 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1119153773 14:72389529-72389551 ATGCTGGCGGGGCCTCTGTAAGG - Intronic
1119595019 14:75925385-75925407 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1120087086 14:80286737-80286759 ATGTGAGGAGCGCCTCTGCCAGG + Intronic
1120193810 14:81462627-81462649 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1120309905 14:82814619-82814641 ATGTGAGGAGTGCCTCTGCCCGG - Intergenic
1120406630 14:84099787-84099809 ATGTGAGGAGTGCCTCTGCCCGG - Intergenic
1121208292 14:92187715-92187737 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1121208336 14:92187869-92187891 ATGTGAGGAGCGCCTCTGCCTGG - Intergenic
1121306830 14:92912024-92912046 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1121531554 14:94658048-94658070 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1122568570 14:102677532-102677554 ATGTGAGGAGCGCCTCTGCTGGG - Intronic
1122957788 14:105079382-105079404 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1122963936 14:105112367-105112389 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1123207331 14:106726177-106726199 ATGAAAGGAGTGACTCTGCAGGG + Intergenic
1123212349 14:106773171-106773193 ATGAAAGGAGTGACTCTGCAGGG + Intergenic
1123429726 15:20204152-20204174 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1124888571 15:33710551-33710573 ACCCCAGGAGGGACTCTGCATGG + Intronic
1125031691 15:35081703-35081725 ATGTGAGGAGTGCCTCTGCCTGG + Intergenic
1125079128 15:35655893-35655915 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1125651431 15:41320947-41320969 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1125659093 15:41382261-41382283 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1125868444 15:43076568-43076590 ATGTGAGGAGCGCCTCTGCTGGG + Intronic
1126125749 15:45293282-45293304 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1126232265 15:46341175-46341197 ATGGTAGCAGGGCCACTCCAAGG + Intergenic
1126295349 15:47132454-47132476 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1126691834 15:51294337-51294359 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1127072824 15:55302545-55302567 ATGCGAGGAGCCCCTCTGCCTGG + Intronic
1127088359 15:55445591-55445613 AGGCGAGGAGCGCCTCTGCCTGG - Intronic
1127088429 15:55445817-55445839 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1127088468 15:55445965-55445987 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1127088505 15:55446079-55446101 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1127088556 15:55446267-55446289 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1127088583 15:55446349-55446371 ATGTGAGGAGTGCCTCTGCCTGG - Intronic
1127088637 15:55446539-55446561 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1127088666 15:55446655-55446677 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1127088695 15:55446769-55446791 ATGTGAGGAGCGCCTCTGCCTGG - Intronic
1127088706 15:55446806-55446828 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1127088740 15:55446920-55446942 ATGTGAGGAGCGCCTCTGCCTGG - Intronic
1127088798 15:55447147-55447169 ATGTGAGGAGCGCCTCTGCCTGG - Intronic
1127192030 15:56540725-56540747 ATGTGAGGAGCGCCTCTGCACGG + Intergenic
1127584214 15:60366470-60366492 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1127644644 15:60946892-60946914 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1128071391 15:64799376-64799398 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1128500088 15:68221777-68221799 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1128500115 15:68221890-68221912 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1128500155 15:68222040-68222062 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1128500266 15:68222421-68222443 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1128597503 15:68964846-68964868 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1128843747 15:70871767-70871789 ATGTGAGGAGAGCCTCTGCCCGG - Intronic
1129054179 15:72807402-72807424 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1129428359 15:75481135-75481157 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1129438214 15:75559153-75559175 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1130152886 15:81324567-81324589 ATGCTAGGGCGGCTGCTGCAGGG + Intergenic
1130340870 15:82998502-82998524 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1130522383 15:84672888-84672910 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1130942661 15:88524103-88524125 ATGTGAGGAGTGCCTCTGCCCGG + Intronic
1130946763 15:88553810-88553832 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1131001451 15:88942043-88942065 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1131125171 15:89853773-89853795 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1131141153 15:89978002-89978024 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1131479403 15:92768651-92768673 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1131526610 15:93157867-93157889 CAGCTAGGAGGGCCTCTGCTGGG + Intergenic
1131528871 15:93175190-93175212 ATGCTACGTGGGCATTTGCAAGG - Intergenic
1131591589 15:93755087-93755109 TTGCTAGCAGGACCTCTTCAAGG + Intergenic
1132037000 15:98493138-98493160 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1132662564 16:1068180-1068202 ATGGTGGGAGGGGCACTGCAGGG - Intergenic
1132776699 16:1599078-1599100 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1132992282 16:2802213-2802235 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1133365079 16:5203122-5203144 ATGTGAGGAGCGCCTCTGCTGGG - Intergenic
1134995282 16:18734385-18734407 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1135250608 16:20898645-20898667 ATGCTAGGAAGTCCTATTCAGGG - Intronic
1135575615 16:23583517-23583539 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1135694527 16:24574978-24575000 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1136160522 16:28416510-28416532 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1136185952 16:28589181-28589203 ATGCTGGGAGGTCCTTTGCTAGG + Intronic
1136202573 16:28698804-28698826 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1136668537 16:31836425-31836447 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1137303884 16:47181163-47181185 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1137388175 16:48059466-48059488 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1137430826 16:48416875-48416897 ATGTGAGGAGTGCCTCTGCCCGG - Intronic
1137439110 16:48483334-48483356 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1137523047 16:49210534-49210556 ATGTGAGGAGTGCCTCTGCCCGG - Intergenic
1138043361 16:53698026-53698048 ATGTGAGGAGTGCCTCTGCCCGG + Intronic
1138307307 16:55989337-55989359 AAGCGAGGAGCGCCTCTGCTCGG + Intergenic
1138400604 16:56740357-56740379 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1138829258 16:60358307-60358329 AAGCAAGGAGTGCCTCTGCCCGG - Intergenic
1139394717 16:66630922-66630944 ATGTGAGGAGCGCCTCTGCCTGG + Intronic
1139556305 16:67712948-67712970 ATGTGAGGAGCGCCTCTGCTGGG + Intronic
1139864156 16:70050988-70051010 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1139885405 16:70204526-70204548 ATGTGAGGAGTGCCTCTGCCCGG + Intergenic
1140063262 16:71589463-71589485 ATGTGAGGAGTGCCTCTGCCCGG + Intergenic
1141141450 16:81499396-81499418 ATCCTAGAAGGGACTCTGAAAGG - Intronic
1141728805 16:85808499-85808521 ATGCGAGGAGCCCCTCTGCCTGG - Intergenic
1142529842 17:572207-572229 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1142705304 17:1690027-1690049 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1142949184 17:3464644-3464666 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1142963250 17:3564459-3564481 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1143282449 17:5764964-5764986 AAGCCAGGAGGGGGTCTGCAGGG + Intergenic
1143342747 17:6226252-6226274 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1143847710 17:9785669-9785691 ATCCTAGGGAGGCCTCTGAAAGG + Intronic
1144541305 17:16145483-16145505 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1144559822 17:16312292-16312314 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1144799012 17:17912517-17912539 ATGTGAGGAGCGCCTCTGCCAGG - Intronic
1145047321 17:19628227-19628249 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1145087018 17:19950933-19950955 ATGGGAGGAGCGCCTCTGCCCGG + Intronic
1145205753 17:20984344-20984366 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1145717157 17:27033777-27033799 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1145733619 17:27212052-27212074 ATGTGAGGAGCGCCTCTGCTGGG + Intergenic
1145762642 17:27434871-27434893 ATGCCAGGGGAGCCTTTGCACGG - Intergenic
1145862785 17:28223730-28223752 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1145891548 17:28419648-28419670 AAGCGAGGAGCGCCTCTGCCCGG + Intergenic
1145895761 17:28456424-28456446 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1145896108 17:28458847-28458869 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1145927450 17:28658947-28658969 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1145927471 17:28659023-28659045 AAGTGAGGAGCGCCTCTGCACGG - Intronic
1145927488 17:28659099-28659121 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1145927509 17:28659178-28659200 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1145927582 17:28659406-28659428 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1145927669 17:28659728-28659750 ATATGAGGAGGGCCTCTGCCCGG - Intronic
1145927681 17:28659765-28659787 ATGTGAGGAGCGCCTCTGCCTGG - Intronic
1146048898 17:29533172-29533194 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1146216457 17:30980694-30980716 ATGTGAGGAGCGCCTCTGCTGGG - Intronic
1146361151 17:32178661-32178683 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1146361199 17:32178849-32178871 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1146361222 17:32178929-32178951 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1146361331 17:32179308-32179330 ATGTGAGGAGCGCCTCTGCCTGG + Intronic
1146361544 17:32180062-32180084 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1146444546 17:32923195-32923217 ATGTGAGGAGCGCCTCTGCTGGG - Intergenic
1146927097 17:36752736-36752758 ATGATAGGAGGGGCTCCCCAAGG - Intergenic
1147024125 17:37565708-37565730 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1147221140 17:38931047-38931069 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1147278377 17:39337570-39337592 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1147709020 17:42449157-42449179 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1147785032 17:42972986-42973008 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1147809736 17:43159603-43159625 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1147963270 17:44180346-44180368 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1148203618 17:45765996-45766018 CAGCTAGGAGGGACCCTGCAGGG + Intergenic
1148269630 17:46253159-46253181 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1148277373 17:46317151-46317173 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1148299580 17:46535016-46535038 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1148672204 17:49419627-49419649 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1148672239 17:49419741-49419763 ATGTGAGGAGTGCCTCTGCCCGG - Intronic
1148672264 17:49419818-49419840 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1149780659 17:59394344-59394366 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1150402929 17:64874271-64874293 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1150557684 17:66268974-66268996 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1150780349 17:68116504-68116526 ATGCGAGGAGCCCCTCTGCCCGG - Intergenic
1151412279 17:73939051-73939073 ATGCAAGGCGGAGCTCTGCAGGG - Intergenic
1152020069 17:77776288-77776310 ATGTGAGGAGCGCCTCTGCTGGG + Intergenic
1152129114 17:78465594-78465616 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1152209288 17:78994494-78994516 ATGCTAGGAGGCCAGCTGCCAGG + Intronic
1152672667 17:81618321-81618343 ATGTGAGGAGCGCCTCTGCCTGG + Intronic
1152696249 17:81798195-81798217 ATGTGAGGAGCGCCTCTGCCTGG - Intergenic
1152824179 17:82453799-82453821 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1152824210 17:82453919-82453941 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1152824219 17:82453956-82453978 ATGTGAGGAGCGCCTCTGCCTGG - Intergenic
1153931120 18:9880638-9880660 ATGCTGGGATGGCCTCTTCCTGG + Intergenic
1154115858 18:11613157-11613179 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1154116183 18:11614365-11614387 ATGTGAGGAGCGCCTCTGCCTGG + Intergenic
1154265080 18:12873759-12873781 ATGTTAGGAGCCCCTCTGCCTGG + Intronic
1154265116 18:12873912-12873934 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1154289982 18:13098511-13098533 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1154398366 18:14011182-14011204 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1154420796 18:14224873-14224895 ATGTGAGGAGCGCCTCTGCCTGG + Intergenic
1154483020 18:14855636-14855658 ATGTGAGGAGTGCCTCTGCCTGG - Intergenic
1154483378 18:14857035-14857057 ATGTGAGGAGTGCCTCTGCCTGG - Intergenic
1154483543 18:14857635-14857657 AGGCGAGGAGCGCCTCTGCCTGG - Intergenic
1154483798 18:14858655-14858677 ATGTGAGGAGTGCCTCTGCCTGG - Intergenic
1154483964 18:14859255-14859277 AGGCGAGGAGCGCCTCTGCCTGG - Intergenic
1154484189 18:14860164-14860186 AGGTGAGGAGCGCCTCTGCATGG - Intergenic
1154943490 18:21137772-21137794 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1155956381 18:31960001-31960023 ATGTTAGGAGCCCCTCTGCCTGG + Intergenic
1155956426 18:31960194-31960216 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1157136099 18:45057165-45057187 CTGCTAGTGAGGCCTCTGCAAGG - Intronic
1157340266 18:46771869-46771891 GTGCTAGTAGGGCCTGAGCATGG - Intergenic
1157639799 18:49202657-49202679 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1157677473 18:49578354-49578376 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1157778468 18:50417464-50417486 AAGTGAGGAGCGCCTCTGCATGG - Intergenic
1157778524 18:50417649-50417671 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1158148526 18:54343125-54343147 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1158613060 18:58960849-58960871 AAGCTAGGAGGGATTTTGCAAGG + Intronic
1159158022 18:64608942-64608964 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1159614941 18:70569877-70569899 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1160916621 19:1499620-1499642 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1161685012 19:5698228-5698250 ATGCTAGGAAGGCCTGAGCCGGG + Intronic
1162163837 19:8739402-8739424 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1162255083 19:9483287-9483309 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1162255877 19:9489251-9489273 AAGCGAGGAGCGCCTCTGCCTGG - Intronic
1162351161 19:10150501-10150523 ATGGCATGAGTGCCTCTGCAGGG - Intronic
1162538216 19:11276860-11276882 ATGTGAGGAGCGCCTCTGCCTGG - Intergenic
1162602197 19:11677401-11677423 ATGCGAGGAGCCCCTCTGCCCGG - Intergenic
1162695038 19:12467765-12467787 ATGTGAGGAGTGCCTCTGCCCGG + Intronic
1162886775 19:13703104-13703126 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1163224177 19:15944148-15944170 ATGATATGAGGACCTCTGCAGGG + Intergenic
1163896505 19:20064620-20064642 ATGCGAGGAGCGCCTCTGCTCGG - Intergenic
1163906004 19:20150380-20150402 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1163921756 19:20296465-20296487 ATGTGAGGAGTGCCTCTGCCCGG + Intergenic
1163986147 19:20952834-20952856 ATGCAGGGAGTGCCTCTGCCCGG - Intergenic
1164016403 19:21259510-21259532 ATGTGAGGAGTGCCTCTGCCCGG - Intronic
1164016548 19:21260078-21260100 ATGTGAGGAGCGCCTCTGCCTGG - Intronic
1164016578 19:21260195-21260217 ATGTGAGGAGTGCCTCTGCCCGG - Intronic
1164016759 19:21260918-21260940 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1164034813 19:21443811-21443833 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1164040256 19:21487185-21487207 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1164043223 19:21511408-21511430 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1164047044 19:21551617-21551639 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1164066408 19:21721010-21721032 ATGTGAGGAGCGCCTCTGCTGGG + Intergenic
1164071806 19:21775860-21775882 ATGTGAGGAGTGCCTCTGCCCGG + Intergenic
1164081857 19:21866199-21866221 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1164105235 19:22105071-22105093 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1164106140 19:22108055-22108077 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1164168584 19:22703265-22703287 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1164191992 19:22925850-22925872 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1164244648 19:23419278-23419300 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1164263893 19:23594783-23594805 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1164653255 19:29901373-29901395 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1165193120 19:34079924-34079946 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1165727744 19:38124333-38124355 ATGTGAGGAGCGCCTCTGCCTGG - Intronic
1165852203 19:38856014-38856036 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1166028667 19:40109048-40109070 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1166163134 19:40966755-40966777 ATGTGAGGAGCGCCTCTGCTGGG - Intergenic
1166180064 19:41102854-41102876 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1166261522 19:41644574-41644596 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1166421514 19:42639933-42639955 ATGTGAGGAGTGCCTCTGCCCGG - Intronic
1166611664 19:44203953-44203975 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1166708425 19:44921847-44921869 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1167588752 19:50391108-50391130 ATGTGAGGAGCGCCTCTGCCTGG - Intronic
1167913210 19:52720712-52720734 ATGTGAGGAGTGCCTCTGCCCGG - Intronic
1167924479 19:52811556-52811578 ATGTGAGGAGCGCCTCTGCTGGG + Intronic
1167937410 19:52919783-52919805 ATGTGAGGAGCGCCTCTGCTGGG + Intergenic
1167971084 19:53187914-53187936 ATGTGAGGAGCGCCTCTGCTGGG - Intronic
1168658262 19:58147175-58147197 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
925400522 2:3569326-3569348 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
926215586 2:10903276-10903298 ATGTGAGGAGCGCCTCTGCCAGG - Intergenic
926322698 2:11760051-11760073 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
926628989 2:15119749-15119771 ATTCTCAGAGGGCCTCTGTAGGG - Intergenic
927737318 2:25535192-25535214 ATGTGAGGAGTGCCTCTGCCCGG - Intronic
927737408 2:25535537-25535559 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
927737567 2:25536112-25536134 ATGTGAGGAGTGCCTCTGCCCGG - Intronic
927833387 2:26371308-26371330 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
927978697 2:27359419-27359441 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
928003260 2:27540720-27540742 ATGTGAGGAGCGCCTCTGCTGGG - Intronic
928005473 2:27558235-27558257 ATGTGAGGAGCGCCTCTGCTGGG - Intronic
928009418 2:27594151-27594173 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
928009440 2:27594225-27594247 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
928542223 2:32294398-32294420 ATGTGAGGAGCGCCTCTGCTCGG - Intronic
928558144 2:32447985-32448007 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
928596865 2:32868451-32868473 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
928888789 2:36179981-36180003 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
929238351 2:39628521-39628543 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
929415964 2:41746742-41746764 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
929577801 2:43063346-43063368 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
929614458 2:43297203-43297225 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
929650834 2:43678081-43678103 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
929690338 2:44067667-44067689 ATGTGAGGAGCGCCTCTGCCTGG - Intergenic
929739496 2:44588142-44588164 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
930202335 2:48557306-48557328 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
930208852 2:48614804-48614826 ATGTGAGGAGGGCCTCGGCCCGG - Intronic
930242962 2:48955241-48955263 ATGCAGGGAGGGCCTAGGCAGGG + Intergenic
930396409 2:50828560-50828582 ATGTAAGGAGCGCCTCTGCCCGG - Intronic
930703924 2:54485855-54485877 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
930833989 2:55774073-55774095 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
931479902 2:62630320-62630342 ATGTGAGGAGCGCCTCTGCCTGG + Intergenic
931656344 2:64512551-64512573 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
932410306 2:71543232-71543254 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
932718901 2:74123883-74123905 ATGTGAGGAGCGCCTCTGCCAGG + Intergenic
933868447 2:86545469-86545491 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
933868912 2:86548853-86548875 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
933869019 2:86549191-86549213 AGGCGAGGAGCGCCTCTGCCCGG - Intronic
933869030 2:86549228-86549250 AGGCGAGGAGCGCCTCTGCCCGG - Intronic
933869186 2:86549754-86549776 AGGCGAGGAGCGCCTCTGCCTGG - Intronic
933869222 2:86549865-86549887 AGGCGAGGAGCGCCTCTGCCCGG - Intronic
934309631 2:91851777-91851799 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
934703416 2:96461456-96461478 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
936546070 2:113394145-113394167 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
937168791 2:119844584-119844606 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
937437568 2:121892729-121892751 ATGTGAGGAGCGCCTCTGCCTGG + Intergenic
937516937 2:122665752-122665774 ATACTAGGAGGTCATCTGCAGGG + Intergenic
937845118 2:126571254-126571276 ATGCGAGCAGTGCCTCTGGAAGG + Intergenic
937867589 2:126765584-126765606 AGGCTTGGTGGGCATCTGCAAGG - Intergenic
937919607 2:127120170-127120192 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
938006206 2:127789032-127789054 ATGTGAGGAGTGCCTCTGCCCGG - Intronic
938055000 2:128208237-128208259 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
938055126 2:128208824-128208846 AAGCGAGGAGCGCCTCTGCCCGG + Intergenic
938055255 2:128209414-128209436 AAGCGAGGAGCGCCTCTGCCCGG + Intergenic
938533765 2:132221026-132221048 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
938821983 2:134968681-134968703 ATGTAAGGAGCGCCTCTGCCCGG - Intronic
939578642 2:143922543-143922565 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
939578692 2:143922736-143922758 ATGTTAGGAGCCCCTCTGCCTGG - Intergenic
940643228 2:156368225-156368247 ATGTGAGGAGCGCCTCTGCTGGG + Intergenic
940652449 2:156451925-156451947 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
940817293 2:158310730-158310752 ATGTGAGGAGTGCCTCTGCCCGG - Intronic
940821448 2:158360283-158360305 ATGCTTGGAGATCCGCTGCAAGG - Intronic
941025075 2:160448918-160448940 ATGTGAGGAGTGCCTCTGCCCGG + Intronic
941197544 2:162470331-162470353 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
941768699 2:169326880-169326902 ATGTGAGGAGTGCCTCTGCCCGG + Intronic
941814842 2:169786703-169786725 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
941822396 2:169856204-169856226 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
942024671 2:171899903-171899925 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
942096139 2:172537835-172537857 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
942621065 2:177845362-177845384 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
943005741 2:182386469-182386491 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
943100303 2:183479134-183479156 ATGTGAGGAGTGCCTCTGCCTGG + Intergenic
943125708 2:183792112-183792134 AAGTGAGGAGGGCCTCTGCCCGG - Intergenic
943125802 2:183792456-183792478 ATGTGAGGAGTGCCTCTGCCCGG - Intergenic
943297222 2:186154342-186154364 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
943418419 2:187637061-187637083 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
943418449 2:187637176-187637198 AAGCGAGGAGCGCCTCTGCCCGG - Intergenic
943418460 2:187637213-187637235 AAGCGAGGAGCGCCTCTGCCCGG - Intergenic
943418470 2:187637250-187637272 AAGTGAGGAGGGCCTCTGCCCGG - Intergenic
943418494 2:187637324-187637346 AAGTGAGGAGGGCCTCTGCCCGG - Intergenic
943418518 2:187637398-187637420 AAGCGAGGAGGGCCTCTGCCCGG - Intergenic
943418540 2:187637472-187637494 ATGTGAGGAGTGCCTCTGCCTGG - Intergenic
943418550 2:187637512-187637534 ATGTGAGGAGCGCCTCTGCCTGG - Intergenic
943648360 2:190431076-190431098 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
943740051 2:191398599-191398621 ATGTGAGGAGCGCCTCTGCTGGG - Intronic
944060672 2:195567847-195567869 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
944283592 2:197923489-197923511 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
944598908 2:201284010-201284032 ATGTGAGGAGCGCCTCTGCTGGG - Intronic
944785606 2:203066824-203066846 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
945232920 2:207610459-207610481 ATGTGAGGAGCGCCTCTGCTGGG + Exonic
945530735 2:210950612-210950634 ATGCGAGGAGCCCCTCTGCCCGG + Intergenic
945530779 2:210950765-210950787 ATGTGAGGAGCGCCTCTGCCTGG + Intergenic
945835849 2:214835688-214835710 ATGTGAGGAGCGCCTCTGCTGGG - Intergenic
945864866 2:215163631-215163653 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
945970474 2:216226889-216226911 ATGTGAGGAGCGCCTCTGCTGGG - Intergenic
946304159 2:218846564-218846586 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
946742552 2:222816220-222816242 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
946751500 2:222897256-222897278 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
947393767 2:229667010-229667032 ATGCCAGGTGGCCCTCTGCCGGG - Intronic
947402306 2:229742803-229742825 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
947901426 2:233724530-233724552 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
948040309 2:234896312-234896334 GTGCTAGAAGGACCTCTCCATGG + Intergenic
948701329 2:239762295-239762317 TTGCCAGGGGGGCCTCTGCCTGG - Intergenic
949044906 2:241867945-241867967 GTGGGAGGAGGTCCTCTGCAGGG + Intergenic
1169085629 20:2823731-2823753 ATGTGAGGAGCGCCTCTGCTGGG + Intergenic
1169125827 20:3125851-3125873 ATGTGAGGAGCGCCTCTGCCTGG + Intronic
1169246867 20:4032551-4032573 ATGTGAGGAGCGCCTCTGCTGGG + Intergenic
1169420329 20:5453601-5453623 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1169441828 20:5639489-5639511 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1169788507 20:9385705-9385727 AAGCGAGGAGCGCCTCTGCCCGG - Intronic
1169908919 20:10631173-10631195 CTGCTAGGAGTGCCCTTGCATGG - Intronic
1170425087 20:16228080-16228102 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1170623175 20:18010846-18010868 ATGTGAGGAGCGCCTCTGCCAGG - Intronic
1170645660 20:18194454-18194476 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1170811665 20:19678874-19678896 ATGTGAGGAGAGCCTCTGCCCGG - Intronic
1171463631 20:25312803-25312825 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1171848516 20:30291983-30292005 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1171861203 20:30404842-30404864 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1171951602 20:31426964-31426986 ATGTGAGGAGCGCCTCTGCCAGG + Intergenic
1171957526 20:31471734-31471756 ATGTGAGGAGCGCCTCTGCCAGG - Intronic
1172051670 20:32122537-32122559 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1172141148 20:32723798-32723820 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1172199586 20:33115626-33115648 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1172237684 20:33389248-33389270 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1172279275 20:33699158-33699180 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1172279917 20:33701393-33701415 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1172348516 20:34223292-34223314 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1172735796 20:37125884-37125906 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1173508475 20:43607501-43607523 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1174445469 20:50587963-50587985 ATGCTAGGACTGGCCCTGCAGGG - Intronic
1175361477 20:58414556-58414578 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1175775937 20:61653716-61653738 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1175859330 20:62142039-62142061 ATGCCAAGAGCACCTCTGCAAGG + Intronic
1176656714 21:9593859-9593881 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1176797481 21:13380565-13380587 AGGCGAGGAGCGCCTCTGCCTGG + Intergenic
1177068116 21:16465230-16465252 ATCCTAGGAGCACCTCTGCGAGG - Intergenic
1177134222 21:17292424-17292446 ATGTGAGGAGTGCCTCTGCCCGG - Intergenic
1177178553 21:17720784-17720806 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1177186170 21:17799901-17799923 TTGCTAGGAGGGACCTTGCAAGG - Intronic
1177788338 21:25695799-25695821 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1178075489 21:29011332-29011354 ATGCGAGGAGCGTCTCTGCCCGG + Intronic
1178113407 21:29392779-29392801 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1179814612 21:43897519-43897541 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1179814624 21:43897556-43897578 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1179814650 21:43897630-43897652 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1179969141 21:44824746-44824768 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1180039459 21:45268647-45268669 ATGTGAGGAGCGCCTCTGCCTGG + Intronic
1180182884 21:46125704-46125726 CTCCAACGAGGGCCTCTGCATGG + Intronic
1180672075 22:17561243-17561265 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1180739324 22:18041797-18041819 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1180830065 22:18900565-18900587 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1180998741 22:19978171-19978193 GTGCTAGGAGGGCAGCAGCAGGG - Intronic
1181137542 22:20779183-20779205 ATGCTGTGAGGGCCTCTTCCTGG + Intronic
1181274013 22:21677221-21677243 ATGTGAGGAGCGCCTCTGCCTGG - Intronic
1181374053 22:22441781-22441803 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1181586083 22:23854477-23854499 ATGTGAGGAGCGCCTCTGCTGGG + Intergenic
1181598865 22:23937105-23937127 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1181617585 22:24065337-24065359 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1181982289 22:26773713-26773735 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1182199340 22:28553450-28553472 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1182343657 22:29644252-29644274 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1182399783 22:30066683-30066705 ATGTGAGGAGCGCCTCTGCCTGG + Intergenic
1182484582 22:30631822-30631844 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1182538856 22:31026943-31026965 ATGTGAGGAGCGCCTCTGCTGGG + Intergenic
1182564039 22:31184287-31184309 ATGTGAGGAGTGCCTCTGCCAGG - Intronic
1182616875 22:31593327-31593349 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1183434716 22:37786851-37786873 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1183537249 22:38410185-38410207 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1183595184 22:38806959-38806981 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1183832433 22:40425469-40425491 CTCCTAGGAGAGCCACTGCAAGG - Intronic
1183841555 22:40502392-40502414 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1183845191 22:40536768-40536790 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1183871756 22:40745729-40745751 ATGTGAGGAGCGCCTCTGCTGGG - Intergenic
1184145464 22:42607732-42607754 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1184202589 22:42981148-42981170 ATGTGAGGAGCGCCTCTGCTGGG + Intronic
1184900003 22:47440122-47440144 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1185283781 22:49990116-49990138 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1203280156 22_KI270734v1_random:125836-125858 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
949992620 3:9591882-9591904 ATGTGAGGAGCGCCTCTGCCTGG + Intergenic
950060786 3:10070086-10070108 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
950253784 3:11487977-11487999 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
950742352 3:15061800-15061822 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
950754938 3:15163472-15163494 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
951013654 3:17705579-17705601 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
951113276 3:18831212-18831234 AGGCAAAGAGAGCCTCTGCAGGG - Intergenic
951274445 3:20668563-20668585 AGTCTAGGAGGGCCTCAGCTGGG + Intergenic
952483755 3:33788812-33788834 TTGCCAGGAGGGTTTCTGCATGG - Intergenic
952892597 3:38053414-38053436 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
952894027 3:38064710-38064732 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
952896600 3:38082127-38082149 ATGTGAGGAGCGCCTCTGCCTGG - Intronic
953307033 3:41840922-41840944 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
953307054 3:41840999-41841021 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
953322322 3:41983417-41983439 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
953425975 3:42797612-42797634 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
953966239 3:47309425-47309447 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
954048323 3:47952014-47952036 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
954059264 3:48055868-48055890 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
954080605 3:48211192-48211214 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
954162711 3:48734171-48734193 ATGTGAGGAGCGCCTCTGCCTGG + Intronic
954481372 3:50804071-50804093 ATGTAAGGAGCGCCTCTGCCCGG - Intronic
954523302 3:51248857-51248879 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
954599761 3:51858656-51858678 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
954641065 3:52098207-52098229 CTGCTAGGGGGTCCTCTGGAAGG - Intronic
955019424 3:55104868-55104890 ATACTAGGAAAGCCACTGCATGG - Intergenic
955256567 3:57338372-57338394 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
955297304 3:57747286-57747308 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
955363134 3:58290710-58290732 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
955394944 3:58550463-58550485 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
955434963 3:58890756-58890778 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
955626814 3:60927608-60927630 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
956270294 3:67443715-67443737 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
956367835 3:68524189-68524211 ATGCCAGGAGGACCTCAGCTGGG + Intronic
957049084 3:75397648-75397670 ATGTGAGGAGCGCCTCTGCCTGG - Intergenic
957316838 3:78583669-78583691 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
958406368 3:93761647-93761669 ATGTGAGGAGCGCCTCTGCCTGG - Intergenic
958406949 3:93763670-93763692 AGGTGAGGAGTGCCTCTGCATGG - Intergenic
958407100 3:93764233-93764255 AAGTGAGGAGGGCCTCTGCCCGG - Intergenic
958407189 3:93764530-93764552 AGGTCAGGAGTGCCTCTGCATGG - Intergenic
958407198 3:93764567-93764589 AGGTGAGGAGTGCCTCTGCACGG - Intergenic
958560841 3:95745124-95745146 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
958808954 3:98838378-98838400 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
959042579 3:101439196-101439218 ATGTGAGGAGTGCCTCTGCCCGG + Intronic
959054071 3:101551474-101551496 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
959162210 3:102736719-102736741 AGGCTAGGAGGGCCTCCCCTGGG - Intergenic
959201736 3:103255232-103255254 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
959201783 3:103255425-103255447 ATGTTAGGAGCCCCTCTGCCTGG - Intergenic
959415783 3:106075120-106075142 ATGTGAGGAGCGCCTCTGCTGGG - Intergenic
959419508 3:106112305-106112327 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
959683742 3:109124037-109124059 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
960389997 3:117065645-117065667 ATGATAGGAGGGCCTATTCAAGG - Intronic
960625034 3:119674112-119674134 ATGTGAGGAGCGCCTCTGCCTGG + Intronic
960817515 3:121688810-121688832 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
960861974 3:122164356-122164378 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
960924451 3:122780886-122780908 ATGTGAGGAGTGCCTCTGCCCGG - Intronic
961120798 3:124368393-124368415 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
961704346 3:128773061-128773083 ATGCGAGGAGCCCCTCTGCCCGG + Intronic
961729178 3:128954269-128954291 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
962063163 3:131952227-131952249 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
962113101 3:132471577-132471599 ATGTGAGGAGTGCCTCTGCCCGG - Intronic
962723927 3:138203505-138203527 ATGCCATGTGGGCCTCTCCACGG + Intronic
962761819 3:138521548-138521570 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
962927675 3:140010555-140010577 ATCCTAGGAAGGACTCTGAATGG + Intronic
963498351 3:146096548-146096570 ATGTGAGGAGCGCCTCTGCTGGG + Intronic
963776424 3:149445152-149445174 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
964485145 3:157178899-157178921 ATGTGAGGAGCGCCTCTGCCTGG - Intergenic
965080283 3:164024206-164024228 ATTTTTGGAGGGCCTCTGTAAGG + Intergenic
965302313 3:167018728-167018750 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
966359534 3:179119821-179119843 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
966617244 3:181926080-181926102 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
966783816 3:183608000-183608022 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
966934089 3:184694489-184694511 ATTCTGGGAGGGTCTCAGCAGGG - Intergenic
967127275 3:186435572-186435594 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
967169424 3:186811802-186811824 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
967176062 3:186864202-186864224 ATGTGAGGAGCGCCTCTGCTGGG + Intergenic
968042461 3:195599876-195599898 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
968139411 3:196244118-196244140 ATGTGAGGAGCGCCTCTGCCAGG + Intronic
968201867 3:196762068-196762090 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
969508358 4:7602447-7602469 ATGTGAGGAGCGCCTCTGCCTGG - Intronic
969639862 4:8390439-8390461 ATGCCAGGGGAGGCTCTGCAGGG - Intronic
970409217 4:15790840-15790862 ATGTGAGGAGCGCCTCTGCTGGG + Intronic
970472765 4:16393632-16393654 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
970669056 4:18375162-18375184 TTGCCAGTAGGGACTCTGCAGGG - Intergenic
970976473 4:22048118-22048140 ATCCCAGTAGGGACTCTGCATGG + Intergenic
971594874 4:28515107-28515129 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
972412389 4:38807504-38807526 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
972552679 4:40147860-40147882 ATGTGAGGAGCGCCTCTGCCTGG - Intronic
972939675 4:44181718-44181740 ATGCCAGGAGCCCCTCTGCCCGG + Intronic
973021129 4:45207339-45207361 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
973021269 4:45207871-45207893 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
973021352 4:45208178-45208200 ATGTGAGGAGCGCCTCTGCCTGG + Intergenic
973021497 4:45208706-45208728 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
973263337 4:48186481-48186503 ATGTGAGGAGCGCCTCTGCCTGG + Intronic
973274350 4:48292389-48292411 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
973281543 4:48364207-48364229 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
973593384 4:52464768-52464790 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
973650412 4:52992651-52992673 ATGTGAGGAGTGCCTCTGCCTGG + Intronic
973675263 4:53256256-53256278 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
973785089 4:54325847-54325869 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
974082119 4:57224306-57224328 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
974848653 4:67380947-67380969 ATGTGAGGAGTGCCTCTGCCCGG + Intergenic
974848732 4:67381257-67381279 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
974848866 4:67381742-67381764 ATGTGAGGAGTGCCTCTGCCCGG + Intergenic
974870527 4:67637016-67637038 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
975908742 4:79245213-79245235 ATGCGAGGAGCCCCTCTGCCTGG + Intronic
976149394 4:82077742-82077764 ATGTGAGGAGTGCCTCTGCCCGG + Intergenic
976265049 4:83182141-83182163 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
976266024 4:83186337-83186359 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
976340895 4:83943993-83944015 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
976976174 4:91168303-91168325 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
976976196 4:91168377-91168399 ATGTGAGGAGTGCCTCTGCCTGG + Intronic
978409103 4:108409487-108409509 ATGTGAGGAGCGCCTCTGCTGGG + Intergenic
978519077 4:109597926-109597948 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
978527142 4:109678521-109678543 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
978527254 4:109678907-109678929 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
979482824 4:121238490-121238512 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
981524125 4:145694075-145694097 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
981904259 4:149903105-149903127 ATGCTAGGAGAGGCTGGGCACGG + Intergenic
981970391 4:150659381-150659403 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
981994765 4:150963656-150963678 ATGCGAGGAGCCCCTCTGCCTGG + Intronic
982022292 4:151215002-151215024 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
982040382 4:151390835-151390857 ATGTGAGGAGCGCCTCTGCTGGG + Intergenic
982600601 4:157443909-157443931 AGGCTAGGAGGTCCTCTCCGGGG + Intergenic
982616020 4:157637426-157637448 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
982784116 4:159522923-159522945 ATGTTAGGAGCCCCTCTGCCTGG + Intergenic
982820962 4:159939986-159940008 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
983468687 4:168128138-168128160 ATGCTAGGAGGAGCACTCCAAGG + Exonic
983604530 4:169570156-169570178 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
983613775 4:169679222-169679244 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
984413818 4:179431856-179431878 ATGGCAGGAGGGCCTCTGACTGG - Intergenic
984804268 4:183737120-183737142 ATGTGAGGAGCGCCTCTGCTGGG - Intergenic
984813726 4:183818839-183818861 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
987093996 5:14532381-14532403 ATGCAAGGAGGGCTCCAGCATGG + Intergenic
988264470 5:28929687-28929709 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
988532521 5:32039688-32039710 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
988532550 5:32039804-32039826 ATGTGAGGAGCGCCTCTGCCTGG + Intronic
988532668 5:32040259-32040281 ATGTGAGGAGCGCCTCTGCACGG + Intronic
988532822 5:32040834-32040856 AAGCGAGGAGCGCCTCTGCCCGG + Intronic
988532953 5:32041249-32041271 AAGCGAGGAGCGCCTCTGCCTGG + Intronic
988760705 5:34307041-34307063 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
988795336 5:34648269-34648291 ATGCTAGGAGAACCCCTGCCTGG + Intergenic
989061620 5:37415842-37415864 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
989068194 5:37483926-37483948 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
989211613 5:38862611-38862633 ATGTGAGGAGCGCCTCTGCCTGG - Intronic
989372250 5:40722530-40722552 ATGTGAGGAGCGCCTCTGCCTGG + Intronic
989588033 5:43088452-43088474 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
989633452 5:43511065-43511087 ATGTGAGGAGCGCCTCTGCCGGG + Intronic
990293858 5:54381366-54381388 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
990297782 5:54420735-54420757 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
990427046 5:55696893-55696915 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
990459127 5:56015304-56015326 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
990498566 5:56372599-56372621 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
990501122 5:56398027-56398049 ATGTGAGGAGTGCCTCTGCCCGG - Intergenic
990567786 5:57047166-57047188 AAGCTAGGGGGAGCTCTGCAAGG - Intergenic
990709087 5:58563198-58563220 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
990709386 5:58564259-58564281 ATGTGAGGAGCGCCTCTGCCTGG - Intergenic
990709462 5:58564567-58564589 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
991207559 5:64066814-64066836 AGGTTAGGAGGGTCACTGCAAGG + Intergenic
991221614 5:64225459-64225481 ATGTGAGGAGTGCCTCTGCCTGG + Intronic
991375118 5:65957991-65958013 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
991690491 5:69220560-69220582 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
991910147 5:71552191-71552213 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
992069611 5:73136724-73136746 AGGCTTGGAGAGCCTCTGCAGGG + Intergenic
992289585 5:75270204-75270226 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
992373799 5:76171404-76171426 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
992442949 5:76812269-76812291 ATGTGAGGAGCGCCTCTGCCAGG + Intergenic
992470146 5:77043911-77043933 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
992574423 5:78096635-78096657 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
992977979 5:82139506-82139528 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
993657915 5:90596121-90596143 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
993934657 5:93986046-93986068 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
995161878 5:108992870-108992892 ATGTGAGGAGCGCCTCTGCCTGG - Intronic
995193263 5:109341304-109341326 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
995236255 5:109833002-109833024 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
995515942 5:112954874-112954896 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
995994454 5:118282646-118282668 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
996070107 5:119122674-119122696 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
996159862 5:120148045-120148067 ATGTGAGGAGTGCCTCTGCCCGG + Intergenic
997321665 5:132983262-132983284 ATGTGAGGAGCGCCTCTGCCTGG - Intergenic
997433469 5:133857751-133857773 ATGTGAGGAGCGCCTCTGCCTGG - Intergenic
997433619 5:133858322-133858344 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
997433629 5:133858361-133858383 ATGTGAGGAGTGCCTCTGCCCGG - Intergenic
997636284 5:135409229-135409251 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
997930687 5:138070158-138070180 ATGCGAGGAGCGTCTCTGCCCGG + Intergenic
998025324 5:138811248-138811270 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
998060039 5:139112469-139112491 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
998074415 5:139224501-139224523 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
999532687 5:152480181-152480203 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
999979033 5:156940580-156940602 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
999986974 5:157014167-157014189 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1000032918 5:157419613-157419635 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1000103474 5:158037369-158037391 ATGTGAGGAGTGCCTCTGCCCGG - Intergenic
1000985316 5:167859134-167859156 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1001077933 5:168643724-168643746 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1001394282 5:171404467-171404489 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1001781714 5:174374462-174374484 ATGCATGCAGGGCCTATGCAGGG - Intergenic
1002013609 5:176304850-176304872 ATGTGAGGAGCGCCTCTGCCTGG + Intronic
1002031520 5:176433784-176433806 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1002115727 5:176961295-176961317 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1002118495 5:176983818-176983840 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1002118681 5:176984463-176984485 ATGTGAGGAGCGCCTCTGCCTGG + Intronic
1002529430 5:179835097-179835119 ATGTGAGGAGCGCCTCTGCCTGG - Intronic
1002626198 5:180531356-180531378 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1003319465 6:5038137-5038159 ATGTGAGGAGCGCCTCTGCTGGG - Intergenic
1004152459 6:13133959-13133981 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1004388028 6:15188791-15188813 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1004620298 6:17325491-17325513 ATATTTGGAGGGCCTCTGTAAGG + Intergenic
1004874322 6:19939364-19939386 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1005069905 6:21852317-21852339 ATGTGAGGAGCGCCTCTGCTGGG - Intergenic
1005414512 6:25586326-25586348 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1005607085 6:27485781-27485803 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1005644743 6:27827807-27827829 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1005837171 6:29718559-29718581 ATGTGAGGAGCGCCTCTGCTGGG + Intergenic
1005860416 6:29896036-29896058 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1005865302 6:29932649-29932671 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1005901723 6:30222229-30222251 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1006065122 6:31455834-31455856 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1006128557 6:31854698-31854720 ATGTGAGGAGTGCCTCTGCCTGG - Intergenic
1006131336 6:31871101-31871123 AGGCAGGGAGGGCCTCTGTAAGG - Intronic
1006149078 6:31976415-31976437 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1006403861 6:33832887-33832909 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1006492210 6:34397324-34397346 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1007545025 6:42686895-42686917 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1008112239 6:47506133-47506155 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1008257444 6:49321443-49321465 GGGGTAGGAGGGCTTCTGCAGGG - Intergenic
1008377647 6:50810140-50810162 ATGTGAGGAGCGCCTCTGCCTGG - Intergenic
1008553780 6:52656251-52656273 ATGTGAGGAGCGCCTCTGCCTGG - Intergenic
1008841645 6:55910357-55910379 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1008926649 6:56895351-56895373 ATGTGAGGAGCGCCTCTGCTGGG - Intronic
1009869170 6:69433317-69433339 AAGCGAGGAGTGCCTCTGCCTGG - Intergenic
1010192084 6:73205731-73205753 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1010239226 6:73601207-73601229 ATGTGAGGAGCGCCTCTGCCTGG + Intronic
1010300660 6:74255336-74255358 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1011405343 6:87010479-87010501 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1011474241 6:87736192-87736214 ATGTGAGGAGTGCCTCTGCCCGG - Intergenic
1011588050 6:88947308-88947330 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1011588198 6:88947759-88947781 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1012428656 6:99142001-99142023 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1012899626 6:104991384-104991406 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1012899665 6:104991537-104991559 ATGTGAGGAGGCCCTCTGCCCGG - Intronic
1013233541 6:108176852-108176874 GTGCTTGGCGGGTCTCTGCATGG + Intronic
1013391879 6:109693558-109693580 ATGCTAGGGGAGCCATTGCATGG + Intronic
1013432085 6:110064305-110064327 AAGCTCGGAAGGCCTCTGGACGG + Intergenic
1013530822 6:111017584-111017606 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1014029244 6:116681747-116681769 AGGCTAGGAGGCCCTCGGGATGG - Intronic
1014557169 6:122849639-122849661 ATGTGAGGAGTGCCTCTGCCCGG - Intergenic
1014764273 6:125389461-125389483 ATGTGAGGAGCGCCTCTGCTGGG - Intergenic
1014800311 6:125770822-125770844 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1015164386 6:130187058-130187080 ATGCTAGGAAGGCCCAGGCACGG - Intronic
1015476618 6:133664634-133664656 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1016123664 6:140374039-140374061 ATGTGAGGAGTGCCTCTGCCCGG - Intergenic
1016476484 6:144433674-144433696 ATGTGAGGAGTGCCTCTGCCCGG - Intronic
1016479914 6:144470437-144470459 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1016973652 6:149786686-149786708 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1017170366 6:151450273-151450295 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1017493853 6:154966598-154966620 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1017851564 6:158309262-158309284 ATGTGAGGAGTGCCTCTGCCCGG - Intronic
1017855746 6:158349217-158349239 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1017855801 6:158349409-158349431 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1017855832 6:158349525-158349547 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1017981877 6:159407324-159407346 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1018295290 6:162338916-162338938 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1018528214 6:164736527-164736549 ATGTGAGGAGGCCCTCTGCCTGG - Intergenic
1019106374 6:169670897-169670919 ATGCTGAGAGAGTCTCTGCAGGG - Intronic
1019439064 7:1037910-1037932 ATGTGAGGAGTGCCTCTGCCCGG + Intronic
1019445711 7:1070013-1070035 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1019459165 7:1147296-1147318 ATGTGAGGAGCGCCTCTGCTGGG - Intergenic
1019668979 7:2267976-2267998 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1019669070 7:2268206-2268228 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1019674405 7:2302766-2302788 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1019715038 7:2534617-2534639 ATGTGAGGAGCGCCTCTGCTGGG - Intergenic
1019981325 7:4624013-4624035 ATGTGAGGAGTGCCTCTGCCCGG + Intergenic
1020157256 7:5736744-5736766 ATGTGAGGAGCGCCTCTGCCAGG + Intronic
1020219355 7:6223128-6223150 AGGCGAGGAGCGCCTCTGCCCGG + Intronic
1020326065 7:6975510-6975532 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1020616549 7:10466099-10466121 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1020831637 7:13102425-13102447 ATGCGAGGAGCCCCTCTGCCTGG + Intergenic
1021440198 7:20668386-20668408 ATGTGAGGAGCGCCTCTGCTGGG + Intronic
1021647336 7:22800831-22800853 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1021672506 7:23046705-23046727 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1021735284 7:23636525-23636547 ATGTGAGGAGCGCCTCTGCTGGG + Intronic
1021872227 7:25018308-25018330 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1021995592 7:26176476-26176498 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1021995601 7:26176515-26176537 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1021995621 7:26176589-26176611 ATGTGAGGAGCGCCTCTGCCTGG - Intronic
1021995630 7:26176628-26176650 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1021995650 7:26176702-26176724 ATGTGAGGAGCGCCTCTGCCTGG - Intronic
1021995701 7:26176891-26176913 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1021995719 7:26176970-26176992 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1021995730 7:26177007-26177029 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1021995748 7:26177086-26177108 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1021995759 7:26177123-26177145 ATGTAAGGAGCGCCTCTGCCCGG - Intronic
1022187839 7:27987279-27987301 ATGTGAGGAGTGCCTCTGCCCGG + Intronic
1022757047 7:33304094-33304116 ATGTGAGGAGTGCCTCTGCCTGG + Intronic
1022757075 7:33304210-33304232 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1023954269 7:44871936-44871958 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1024625790 7:51208094-51208116 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1024910743 7:54444337-54444359 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1024989234 7:55220521-55220543 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1025102798 7:56150230-56150252 ATGTTAGGAGCCCCTCTGCCTGG + Intergenic
1025102842 7:56150423-56150445 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1025706839 7:63874204-63874226 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1025778277 7:64577381-64577403 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1025778307 7:64577497-64577519 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1025793633 7:64717948-64717970 ATGTGAGGAGCGCCTCTGCCTGG + Intergenic
1025800804 7:64784775-64784797 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1025808242 7:64856175-64856197 ATGTGAGGAGTGCCTCTGCCCGG + Intergenic
1025828949 7:65033585-65033607 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1025852817 7:65258094-65258116 ATGTGAGGAGCGCCTCTGCTGGG + Intergenic
1025875609 7:65477713-65477735 ATTTTTGGAGGGCCTCTGTAAGG - Intergenic
1025979563 7:66394446-66394468 ATGTGAGGAGCGCCTCTGCTGGG - Intronic
1026007960 7:66614540-66614562 ATGCGAGGAGCCCCTCTGCCCGG + Intergenic
1026186028 7:68082866-68082888 ATGTAAGGAGCGCCTCTGCCGGG + Intergenic
1026186105 7:68083166-68083188 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1026186144 7:68083319-68083341 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1026186163 7:68083390-68083412 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1026186185 7:68083467-68083489 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1026783481 7:73284655-73284677 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1027182979 7:75952653-75952675 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1027183024 7:75952846-75952868 ATGTTAGGAGCCCCTCTGCCTGG - Intronic
1027371039 7:77509076-77509098 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1027826743 7:83125225-83125247 ATGTGAGGAGTGCCTCTGCCCGG + Intronic
1028535588 7:91887471-91887493 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1028535628 7:91887619-91887641 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1028535674 7:91887773-91887795 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1028535728 7:91887964-91887986 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1028535832 7:91888345-91888367 ATGTGAGGAGCGCCTCTGCCTGG + Intergenic
1028535985 7:91888914-91888936 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1028536035 7:91889105-91889127 ATGTGAGGAGCGCCTCTGCCTGG + Intergenic
1028548232 7:92027370-92027392 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1028548303 7:92027633-92027655 ATGTGAGGAGCGCCTCTGCCTGG + Intronic
1028548313 7:92027670-92027692 ATGTGAGGAGCGCCTCTGCCTGG + Intronic
1028548323 7:92027707-92027729 ATGTGAGGAGCGCCTCTGCCTGG + Intronic
1028811825 7:95096616-95096638 ATGCTTTTAGGGACTCTGCATGG + Intronic
1029044082 7:97608998-97609020 ATGATGGGAGGGCCTCGGCAGGG - Intergenic
1029279418 7:99426840-99426862 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1029525680 7:101092412-101092434 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1030288280 7:107848177-107848199 ATGTGAGGAGCGCCTCTGCCTGG + Intergenic
1030329317 7:108255713-108255735 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1030602738 7:111609974-111609996 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1030692671 7:112551680-112551702 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1031022066 7:116638895-116638917 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1032056593 7:128689272-128689294 ATGCGAGGAGCCCCTCTGCCCGG + Intergenic
1032056629 7:128689417-128689439 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1032129471 7:129216434-129216456 ATGTGAGGAGTGCCTCTGCCCGG + Intergenic
1032156946 7:129476548-129476570 ATGTGAGGAGTGCCTCTGCCCGG - Intronic
1032156986 7:129476699-129476721 ATGCAAGGAGCCCCTCTGCCCGG - Intronic
1032179525 7:129663423-129663445 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1033185643 7:139225411-139225433 ATGTGAGGAGCGCCTCTGCCTGG + Intergenic
1033185652 7:139225448-139225470 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1033219777 7:139520382-139520404 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1033323734 7:140362214-140362236 ATGTGAGGAGCGCCTCTGCTGGG + Intronic
1034034172 7:147802147-147802169 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1034322479 7:150198508-150198530 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1034638880 7:152586567-152586589 ATGTGAGGAGCGCCTCTGCTGGG - Intergenic
1034913175 7:155015081-155015103 ACTTTAGAAGGGCCTCTGCACGG + Intergenic
1035508027 8:150261-150283 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1035612078 8:973444-973466 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1036481987 8:9148161-9148183 TTGCTAGGAGTACTTCTGCATGG - Intronic
1036507031 8:9365324-9365346 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1036536791 8:9657972-9657994 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1037134623 8:15446138-15446160 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1037756293 8:21712338-21712360 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1038176158 8:25184025-25184047 TTGCTAGGGGATCCTCTGCAGGG - Intergenic
1038348924 8:26758693-26758715 ATGCTAGGAAGGGCACTGGAAGG - Intronic
1038396619 8:27250499-27250521 ATGCTCTGCGGGCCTCAGCATGG + Intronic
1038595082 8:28880920-28880942 ATGTGAGGAGCGCCTCTGCTGGG + Intronic
1038745088 8:30248056-30248078 AAGCCACGAGGGCCTCTGCCAGG + Intergenic
1039026795 8:33267383-33267405 AAGCCAGGAGGAGCTCTGCAAGG - Intergenic
1039072291 8:33658514-33658536 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1039459135 8:37728801-37728823 ATGTTAGGAGTGTGTCTGCATGG - Intergenic
1039650945 8:39339387-39339409 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1039753192 8:40496598-40496620 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1039807621 8:41014505-41014527 ATGTTAGGAGCACCTCTGCCTGG - Intergenic
1039881224 8:41626597-41626619 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1040052857 8:43033227-43033249 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1040070042 8:43180427-43180449 ATGTGAGGAGTGCCTCTGCTGGG - Intronic
1040093409 8:43419863-43419885 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1040121359 8:43687971-43687993 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1040818620 8:51534148-51534170 ATGTGAGGAGCGCCTCTGCTGGG + Intronic
1040882555 8:52222613-52222635 ATGGATGGAGAGCCTCTGCAGGG - Intronic
1040917027 8:52573736-52573758 ATGTGAGGAGTGCCTCTGCCCGG - Intergenic
1041066231 8:54085602-54085624 ATGTGAGGAGCGCCTCTGCCTGG + Intronic
1041270474 8:56104786-56104808 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1041358021 8:57021898-57021920 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1041362953 8:57071612-57071634 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1041796691 8:61753413-61753435 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1042048898 8:64685529-64685551 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1042133943 8:65616604-65616626 ATGTGAGGAGTGCCTCTGCCCGG + Intronic
1042290773 8:67167668-67167690 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1042303502 8:67310721-67310743 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1042475655 8:69245680-69245702 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1042554689 8:70023989-70024011 TTGAAAGGATGGCCTCTGCAAGG - Intergenic
1043986049 8:86694631-86694653 ATGTGAGGAGTGCCTCTGCCCGG - Intronic
1044507586 8:93039236-93039258 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1044581880 8:93833364-93833386 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1044582300 8:93834749-93834771 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1044597263 8:93970900-93970922 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1044660548 8:94590559-94590581 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1045120479 8:99029109-99029131 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1045195624 8:99927243-99927265 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1045850846 8:106696866-106696888 AAGCCATGAGGGCCTCTGCCAGG + Intronic
1046636242 8:116678657-116678679 ATGTGAGGAGCGCCTCTGCTGGG + Intronic
1046703644 8:117427098-117427120 AAGCGAGGAGCGCCTCTGCCCGG + Intergenic
1046703656 8:117427135-117427157 AGGCGAGGAGCGCCTCTGCCCGG + Intergenic
1046703709 8:117427325-117427347 AAGCGAGGAGCGCCTCTGCCCGG + Intergenic
1046736014 8:117777613-117777635 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1047388631 8:124432201-124432223 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1047848188 8:128826798-128826820 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1049031838 8:140043870-140043892 AGGCTGGGAGGGCCACTGGAGGG - Intronic
1049177452 8:141202521-141202543 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1049401817 8:142431260-142431282 ATGCCAGGCAAGCCTCTGCAGGG - Intergenic
1049481651 8:142827181-142827203 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1049734891 8:144199648-144199670 TGGCTATGAGGGCCTGTGCAGGG - Intronic
1049805450 8:144536737-144536759 ATGCCAGGATGGCATCTGCTGGG - Intronic
1050417556 9:5433044-5433066 ATGTGAGGAGGGCCTCTGCCCGG + Intronic
1050417640 9:5433394-5433416 ATGTGAGGAGCGCCTCTGCCTGG + Intronic
1050417678 9:5433547-5433569 ATGTGAGGAGTGCCTCTGCCCGG + Intronic
1050417706 9:5433660-5433682 ATGTGAGGAGTGCCTCTGCCCGG + Intronic
1050417732 9:5433773-5433795 ATGTGAGGAGTGCCTCTGCCTGG + Intronic
1050417758 9:5433886-5433908 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1050558138 9:6807546-6807568 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1050571915 9:6949257-6949279 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1050862313 9:10449660-10449682 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1051258041 9:15234057-15234079 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1051281088 9:15442542-15442564 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1051615062 9:18999306-18999328 ATGTGAGGAGTGCCTCTGCCTGG + Intronic
1051661917 9:19434104-19434126 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1052236180 9:26215076-26215098 AGGTGAGGAGGGCCTCTGCCCGG - Intergenic
1052259031 9:26492464-26492486 AAGCGAGGAGCGCCTCTGCCCGG + Intergenic
1052259060 9:26492580-26492602 ATGTGAGGAGCGCCTCTGCCTGG + Intergenic
1052259081 9:26492659-26492681 ATGTGAGGAGCGCCTCTGCCTGG + Intergenic
1052259090 9:26492696-26492718 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1052259111 9:26492775-26492797 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1052259136 9:26492852-26492874 AGGCGAGGAGCGCCTCTGCCTGG + Intergenic
1052259156 9:26492931-26492953 ATGTGAGGAGTGCCTCTGCCCGG + Intergenic
1052259178 9:26493008-26493030 AGGCGAGGAGCGCCTCTGCCCGG + Intergenic
1052274815 9:26664356-26664378 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1052492897 9:29189462-29189484 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1052881021 9:33600952-33600974 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1052887981 9:33667734-33667756 ATGTGAGGAGTGCCTCTGCCCGG + Intergenic
1053081823 9:35183623-35183645 ATGTGAGGAGTGCCTCTGCCCGG - Intronic
1053081852 9:35183736-35183758 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1053081861 9:35183775-35183797 ATGTGAGGAGCGCCTCTGCCTGG - Intronic
1053081871 9:35183814-35183836 AGGCGAGGAGCGCCTCTGCCCGG - Intronic
1053081883 9:35183851-35183873 AGGCAAGGAGCGCCTCTGCCCGG - Intronic
1053081944 9:35184081-35184103 ATGTGAGGAGTGCCTCTGCTCGG - Intronic
1053255956 9:36615686-36615708 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1053457154 9:38241895-38241917 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1053715871 9:40886159-40886181 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1054846015 9:69799573-69799595 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1055137574 9:72841703-72841725 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1055242050 9:74197469-74197491 ATGTGAGGAGTGCCTCTGCCCGG + Intergenic
1055297961 9:74853075-74853097 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1055414386 9:76064742-76064764 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1055518911 9:77060934-77060956 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1055585973 9:77760678-77760700 ATGTTAGGAGCCCCTCTGCCTGG + Intronic
1055586018 9:77760871-77760893 ATGTGAGGAGTGCCTCTGCCCGG + Intronic
1055843900 9:80537710-80537732 TTGCTAGTGGGGACTCTGCAGGG - Intergenic
1055948238 9:81710204-81710226 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1056097806 9:83272804-83272826 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1056152469 9:83803917-83803939 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1056229381 9:84527476-84527498 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1056336415 9:85573768-85573790 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1056670838 9:88626146-88626168 ATGTGAGGAGCGCCTCTGCCTGG + Intergenic
1057263912 9:93601653-93601675 GTGCAGGGAGGGCCTCAGCAAGG + Intronic
1057553003 9:96065792-96065814 TTGCTGGCAGGGACTCTGCAGGG - Intergenic
1057674918 9:97130812-97130834 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1057838236 9:98464221-98464243 ATGTGAGGAGCGCCTCTGCCTGG + Intronic
1058049627 9:100392930-100392952 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1058049662 9:100393044-100393066 ATGTGAGGAGCGCCTCTGCCTGG + Intergenic
1058049720 9:100393272-100393294 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1058244211 9:102603566-102603588 ATGTGAGGAGTGCCTCTGCCCGG - Intergenic
1058368151 9:104234784-104234806 ATGTGAGGAGCGCCTCTGCCAGG - Intergenic
1058368328 9:104235431-104235453 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1058659988 9:107257839-107257861 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1058722485 9:107776020-107776042 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1059118185 9:111617746-111617768 ATGCGAGGAGCCCCTCTGCCCGG - Intergenic
1059120748 9:111640590-111640612 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1059210943 9:112514055-112514077 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1060064863 9:120495408-120495430 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1060351743 9:122867027-122867049 ATGTGAGGAGCGCCTCTGCCTGG + Intronic
1060351964 9:122867688-122867710 ATGTGAGGAGCGCCTCTGCCTGG + Intronic
1060669816 9:125459146-125459168 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1060687018 9:125623460-125623482 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1061635799 9:131907882-131907904 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1061914826 9:133744675-133744697 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1062489728 9:136799344-136799366 ATGTGAGGAGGGGCTCTGCTAGG + Intronic
1185584596 X:1235429-1235451 ATGAGAGGAGCGCCTCTGCCCGG + Intergenic
1186607844 X:11110459-11110481 ATCCTATGAGGGTCTCTGCAAGG - Intergenic
1186786865 X:12963311-12963333 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1187212549 X:17245058-17245080 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1187212578 X:17245174-17245196 ATGTGAGGAGCGCCTCTGCCTGG - Intergenic
1187976611 X:24709721-24709743 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1188086388 X:25905880-25905902 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1188368018 X:29334647-29334669 ATGTGAGGAGCGCCTCTGCTGGG - Intronic
1189421505 X:40861979-40862001 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1189421556 X:40862156-40862178 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1189421633 X:40862427-40862449 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1189421644 X:40862464-40862486 AAGCGAGGAGCGCCTCTGCCCGG + Intergenic
1189421679 X:40862575-40862597 AGGCGAGGAGCGCCTCTGCCCGG + Intergenic
1189570059 X:42285951-42285973 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1189825315 X:44911398-44911420 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1189882139 X:45504139-45504161 ATGTGAGGAGAGCCTCTGCCCGG - Intergenic
1189955772 X:46275373-46275395 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1190521076 X:51279954-51279976 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1190769588 X:53504072-53504094 ATGTGAGGAGTGCCTCTGCCCGG + Intergenic
1190778938 X:53578186-53578208 ATGTGAGGAGCGCCTCTGCTGGG + Intronic
1190793576 X:53721683-53721705 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1190820275 X:53966896-53966918 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1190839193 X:54129351-54129373 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1190891546 X:54572877-54572899 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1191009852 X:55748532-55748554 ATGTGAGGAGCGCCTCTGCTGGG + Intronic
1191835333 X:65457106-65457128 ATGTGAGGAGCGCCTCTGCTGGG + Intronic
1191894259 X:65975569-65975591 ATGTGAGGAGCGCCTCTGCCTGG - Intergenic
1192106962 X:68326527-68326549 ATGTGAGGAGCGCCTCTGCTGGG + Intronic
1192123531 X:68478951-68478973 ATGTGAGGAGTGCCTCTGCCCGG + Intergenic
1192350004 X:70349242-70349264 ATGTGAGGAGTGCCTCTGCCCGG - Intronic
1192455132 X:71269934-71269956 ATGTGAGGAGCGCCTCTGCCTGG - Intergenic
1192505197 X:71676832-71676854 ATGTGAGGAGTGCCTCTGCCAGG + Intergenic
1192505207 X:71676869-71676891 ATGTGAGGAGTGCCTCTGCCAGG + Intergenic
1192505217 X:71676906-71676928 ATGTGAGGAGTGCCTCTGCCAGG + Intergenic
1192505227 X:71676943-71676965 ATGTGAGGAGTGCCTCTGCCAGG + Intergenic
1192505237 X:71676980-71677002 ATGTGAGGAGTGCCTCTGCCAGG + Intergenic
1192530272 X:71877116-71877138 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1192621164 X:72681189-72681211 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1192663693 X:73068301-73068323 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1192664073 X:73069531-73069553 AGGTGAGGAGCGCCTCTGCATGG + Intergenic
1192761273 X:74098394-74098416 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1192768490 X:74166375-74166397 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1192813539 X:74569147-74569169 ATGCGAGGAGCGCCTCTGCCTGG - Intergenic
1192885733 X:75334933-75334955 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1192969929 X:76218552-76218574 ATGTGAGGAGCGCCTCTGCCCGG - Intergenic
1193047218 X:77066095-77066117 ATGTGAGGAGTGCCTCTGCCCGG + Intergenic
1193068030 X:77279325-77279347 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1193114883 X:77766552-77766574 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1193132445 X:77932236-77932258 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1193517225 X:82481066-82481088 ATTCTATGAAGCCCTCTGCATGG - Intergenic
1193924331 X:87465974-87465996 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1195036237 X:100973045-100973067 ATGTGAGGAGTGCCTCTGCCCGG - Intronic
1196404531 X:115347921-115347943 ATGTAAGGAGCGCCTCTGCCCGG - Intergenic
1197199278 X:123734193-123734215 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1197452899 X:126641342-126641364 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1197455629 X:126673843-126673865 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1198246822 X:134839319-134839341 ATGTGAGGAGCGCCTCTGCCCGG + Intronic
1198260391 X:134960324-134960346 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1198429182 X:136548730-136548752 TGGCTAGGAGGGCCTCTGTTCGG + Exonic
1198476326 X:137000359-137000381 AGGTTAGGAGCGCCTCTGCCCGG - Intergenic
1199230944 X:145436291-145436313 ATGTGAGGAGCGCCTCTGCCCGG + Intergenic
1199452740 X:147992748-147992770 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1199836794 X:151599636-151599658 ATGTGAGGAGCGCCTCTGCCCGG - Intronic
1199836832 X:151599789-151599811 ATGTGAGGAGGCCCTCTGCCCGG - Intronic
1201294693 Y:12453413-12453435 ATGTGAGGAGCGCCTCTGCCTGG - Intergenic
1202028827 Y:20551990-20552012 AGGCGAGGAGCGCCTCTGCCCGG + Intergenic