ID: 1077777593

View in Genome Browser
Species Human (GRCh38)
Location 11:5288538-5288560
Sequence TTGTCTCCACACACCAGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 165}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077777590_1077777593 -1 Left 1077777590 11:5288516-5288538 CCCATCTATTATAAACCTGCATT 0: 1
1: 0
2: 2
3: 20
4: 191
Right 1077777593 11:5288538-5288560 TTGTCTCCACACACCAGTCATGG 0: 1
1: 0
2: 1
3: 15
4: 165
1077777589_1077777593 3 Left 1077777589 11:5288512-5288534 CCATCCCATCTATTATAAACCTG 0: 1
1: 0
2: 0
3: 15
4: 444
Right 1077777593 11:5288538-5288560 TTGTCTCCACACACCAGTCATGG 0: 1
1: 0
2: 1
3: 15
4: 165
1077777591_1077777593 -2 Left 1077777591 11:5288517-5288539 CCATCTATTATAAACCTGCATTT 0: 1
1: 0
2: 2
3: 21
4: 281
Right 1077777593 11:5288538-5288560 TTGTCTCCACACACCAGTCATGG 0: 1
1: 0
2: 1
3: 15
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077777593 Original CRISPR TTGTCTCCACACACCAGTCA TGG Intronic
900242820 1:1625025-1625047 CTGTCTCCACATCCCAGCCACGG - Exonic
900525072 1:3124608-3124630 GTGGCTCCACACACCAGGCCTGG - Intronic
903013257 1:20345054-20345076 TGGTCCCCACCCACCAGCCAGGG + Intronic
903194010 1:21671652-21671674 TTGTCTCCACTCAGCACTCTGGG - Intergenic
903315311 1:22499186-22499208 TGGTCTCCAGCCAACAGTCAGGG - Intronic
904027961 1:27516572-27516594 ATGGCTCCACACACAAGTCACGG - Intergenic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
906694384 1:47814368-47814390 CTTTCTCCACACAGCAGCCAGGG - Intronic
912413155 1:109491465-109491487 TCAGCTCCCCACACCAGTCAAGG + Exonic
915958806 1:160246620-160246642 TTGTCTCTATAAATCAGTCAAGG + Intronic
919143285 1:193601014-193601036 CTGTCTCCACACACAATTCTAGG - Intergenic
919970145 1:202571033-202571055 CAGCCTCCACTCACCAGTCATGG + Intronic
920041430 1:203100194-203100216 TTGTGTCCTCACACCACTGAAGG + Intronic
923120070 1:230981640-230981662 TTCTCTCCACACAGTAGCCAGGG + Intronic
923600664 1:235399883-235399905 TTTTCCCCACACACCAAGCAGGG - Intronic
1064653609 10:17534984-17535006 TTGTCGTCACTCACCAGTCAGGG - Intergenic
1065045730 10:21746480-21746502 ATGTCACCACACTCCAGCCAGGG + Intergenic
1065892341 10:30131975-30131997 GTGTCTCCACTCTCCACTCAGGG + Intergenic
1067084917 10:43232860-43232882 CTGTCTCCACACAGCAGCCGGGG + Intronic
1067543610 10:47175883-47175905 TAGTCTCCACGCACGAGACAGGG - Intergenic
1068541942 10:58304570-58304592 TTGTCTCCTCTCTCCAGTCTCGG - Intergenic
1070825083 10:79386179-79386201 TTGTCAACACACACAAGACAAGG + Exonic
1072230044 10:93407024-93407046 TTCTCCCCACAGCCCAGTCATGG + Intronic
1073740955 10:106406381-106406403 AAGTCTCCACACAGCAGCCAGGG - Intergenic
1075193007 10:120328742-120328764 TTTTCTCCACACAGCACTCCAGG - Intergenic
1075640155 10:124058872-124058894 TTGTGTCCAGACACCAGGCTGGG + Intronic
1076522677 10:131090821-131090843 CTGGCTCCAGACACCAGTCATGG - Intergenic
1077777593 11:5288538-5288560 TTGTCTCCACACACCAGTCATGG + Intronic
1078942622 11:16024900-16024922 CTGTCTCCACACCCCCGGCAAGG + Intronic
1080010812 11:27457769-27457791 GTTTCTCCATTCACCAGTCAAGG - Intronic
1080395725 11:31888111-31888133 TTTTCTCCACACAGCAATCAAGG - Intronic
1083717538 11:64586462-64586484 TGTTCTCCACACAGCAGCCAGGG + Intergenic
1086505044 11:87495966-87495988 TTTTCTCCCCACAACAGTCAAGG - Intergenic
1088214673 11:107494707-107494729 TCATCTCCACACAGCAGCCACGG + Intergenic
1089457595 11:118634499-118634521 TTTTCTCTCCAAACCAGTCAAGG - Intronic
1090107299 11:123867078-123867100 TAATCGCCACACACCAGCCAAGG - Intergenic
1090163355 11:124518728-124518750 TTGTCTCCAGACACCAGAGTTGG + Intergenic
1092650686 12:10631590-10631612 TTGTCTCCATACCACACTCATGG - Intronic
1094396808 12:30015746-30015768 TTTTCTCAACACTCCTGTCAGGG + Intergenic
1096836807 12:54356390-54356412 TTGTCTCTACTCAGCAGACAGGG + Intergenic
1098030272 12:66246520-66246542 TTGGCTCCACACAACTCTCACGG - Intronic
1099106479 12:78503010-78503032 TTGACTACAAACAACAGTCATGG - Intergenic
1103162343 12:118740000-118740022 TAGTCTCTAGACACCAGTCCAGG + Intergenic
1104792171 12:131490287-131490309 TTCTCTCCACACTCCAGCCCAGG + Intergenic
1105033294 12:132900189-132900211 TTGTCTTCACACAGCAGTGGAGG - Intronic
1108632651 13:52302016-52302038 GTGTATCCACATACCAGGCATGG - Intergenic
1108654048 13:52510577-52510599 GTGTATCCACATACCAGGCATGG + Intergenic
1112682843 13:101786922-101786944 TTTTCTCAACACACAAGCCAGGG + Intronic
1112809141 13:103197440-103197462 TTGTCTACAGACAGGAGTCAGGG - Intergenic
1113863031 13:113502657-113502679 CTGTCTCCCCACAACACTCACGG + Intronic
1117212222 14:53512576-53512598 TGTTCTCCACAAAGCAGTCAGGG - Intergenic
1117441872 14:55767511-55767533 TATTCTCCACATAGCAGTCAGGG - Intergenic
1119886438 14:78147329-78147351 TTGTCACCATCCACCAGCCAGGG + Intergenic
1122955909 14:105070974-105070996 CTGACTTCAGACACCAGTCATGG + Intergenic
1123163983 14:106308348-106308370 GTGCCTCCACACACCAGCCTTGG - Intergenic
1123505720 15:20940544-20940566 TTGCCACCACACACCATTCAAGG - Intergenic
1123562954 15:21514250-21514272 TTGCCACCACACACCATTCAAGG - Intergenic
1123599201 15:21951533-21951555 TTGCCACCACACACCATTCAAGG - Intergenic
1124528822 15:30485003-30485025 TTGCCTCCACACTCCAGCCTGGG - Intergenic
1124769835 15:32522690-32522712 TTGCCTCCACACTCCAGCCTGGG + Intergenic
1126270659 15:46813564-46813586 TTGGGACCACACACCAGTCCTGG - Intergenic
1126676939 15:51167753-51167775 GTGTTTCCACACCCCAGTCCTGG + Intergenic
1128694365 15:69749384-69749406 CTGTCTCCACACGCCAGCCATGG + Intergenic
1130073823 15:80671460-80671482 TGGTCCCCACACCCAAGTCAGGG + Intergenic
1131051972 15:89354329-89354351 TGGTCTCCACACACAGGTCTGGG + Intergenic
1131065588 15:89433263-89433285 GTGTCTCCAGACACCAGTTCAGG - Intergenic
1131139195 15:89963443-89963465 TTGTGGCCACCCAGCAGTCAAGG + Intergenic
1131411827 15:92213899-92213921 TTGTTTACACTAACCAGTCAAGG + Intergenic
1202971306 15_KI270727v1_random:241385-241407 TTGCCACCACACACCATTCAAGG - Intergenic
1133226909 16:4345256-4345278 CTGAGTCCACACACCAGGCACGG + Intronic
1134091284 16:11392894-11392916 GTGTCACCACACACCAGCCTAGG - Intronic
1136504169 16:30692210-30692232 ATGTCTCCACACAGCAGCCAGGG - Intergenic
1137623498 16:49892509-49892531 CTCTCTGCACACACCTGTCAGGG + Intergenic
1140944245 16:79752929-79752951 TTGTCTCCACACCTCCTTCAAGG - Intergenic
1144636351 17:16911512-16911534 GTGTCCCCACACCCCAGGCAGGG + Intergenic
1156184590 18:34647252-34647274 ATGTCTCCACCTACCAGTCCAGG + Intronic
1156736564 18:40266656-40266678 TTCCCTCCCCACACCAGACATGG - Intergenic
1158097681 18:53792923-53792945 CTTTCTCCACACAGCAGCCATGG + Intergenic
1159017701 18:63115076-63115098 TTTTCCCCACACACCAAGCAGGG - Intergenic
1159146838 18:64465552-64465574 TGCTCTCCACACAACAGCCAGGG - Intergenic
1161433703 19:4249344-4249366 GTGACCCCACACACCAGTCATGG + Intronic
1163130840 19:15271948-15271970 TGGTGTGCACACACCAGTCTGGG + Intronic
1168319449 19:55500421-55500443 TTCTCTCCCCACACCCCTCACGG - Intronic
925828561 2:7874407-7874429 TAATCTCCACACACCAGCAAAGG - Intergenic
926785044 2:16510180-16510202 TTGTCTCAACACACCTGTATAGG + Intergenic
928390951 2:30910632-30910654 CTGTCTCCAGATACCAATCAGGG + Exonic
928440430 2:31287660-31287682 TTGTCTCCACTCATAAGTTATGG - Intergenic
928857441 2:35817090-35817112 TAGTCGCCACACACCAGCAAAGG + Intergenic
931694543 2:64861916-64861938 TTCTCTCCACCCACCACCCATGG + Intergenic
933626103 2:84601675-84601697 TGGTCTACACACACCTGTTAAGG - Intronic
933847213 2:86336312-86336334 TTGTCTCCCGCCACCATTCAGGG - Intronic
935038067 2:99398266-99398288 TTTTCTCCACAAAGGAGTCAGGG + Intronic
935494718 2:103766113-103766135 TTATCTCCACTAACCAATCAGGG + Intergenic
941636377 2:167939590-167939612 TTGTCTCCACACAAAAACCAAGG - Intergenic
942575161 2:177355522-177355544 TTGTCTCCACATAGCAATGAAGG + Intronic
944875848 2:203963625-203963647 TAATCTCCACACACCAGCAAAGG - Intergenic
1171190652 20:23156848-23156870 TGGTCTCCATACACCTTTCAGGG - Intergenic
1175156814 20:56976847-56976869 CAGTGTCCACACACCTGTCATGG - Intergenic
1175796422 20:61774088-61774110 GTGCCTCCACACCCCAGCCAAGG + Intronic
1179591786 21:42413864-42413886 TTCTCTCCAAACACCAGCCCTGG + Intronic
1181318211 22:21984895-21984917 TGTTCTCCACATACCAGCCAGGG + Intergenic
1181474824 22:23161618-23161640 CAGTCTCCACACCACAGTCACGG - Exonic
1183394588 22:37564024-37564046 TGGGCTCCACAAGCCAGTCAAGG + Intronic
950234396 3:11306200-11306222 TTGTCTGCAGACAACCGTCAGGG + Intronic
952187602 3:30987118-30987140 TCTTTTCCACATACCAGTCATGG - Intergenic
952793143 3:37216357-37216379 CTGTCTCAACACCTCAGTCAGGG - Intergenic
954385898 3:50243610-50243632 TCAGCTCCACACAACAGTCAAGG - Intronic
956151778 3:66251241-66251263 TTATCTCCACACAGCTGCCAGGG - Intronic
957729280 3:84111648-84111670 TTGTCACCACACTCCAGCCTGGG + Intergenic
958091924 3:88887338-88887360 TTGTCTCCCCACAAAATTCATGG + Intergenic
958816201 3:98918813-98918835 TCTTCTCCACATTCCAGTCAGGG - Intergenic
960996517 3:123343880-123343902 TTGTCACCACACGTCAGACAGGG + Intronic
963161568 3:142156125-142156147 ATGTCACCACACTCCAGTCTGGG - Intergenic
963374255 3:144443376-144443398 TTGTCTCCACACACAATTAGAGG - Intergenic
964962665 3:162447299-162447321 AATTCTCCACACAGCAGTCAAGG - Intergenic
966365418 3:179181123-179181145 CTGTCACCACACACCAGATATGG + Intronic
968870757 4:3240956-3240978 CGTTCTCCACCCACCAGTCAGGG + Exonic
969514277 4:7637925-7637947 GTTTCTCCACACACCAGGGAGGG - Intronic
969606409 4:8204377-8204399 TTCTCACCACACATCAGGCACGG + Intronic
970282114 4:14468652-14468674 GTGTCTACACACACCAGTTCTGG + Intergenic
975933616 4:79555682-79555704 TAATCGCCACACACCAGTAAAGG - Intergenic
976302133 4:83525295-83525317 ATGTCACCACACACCAGCCTGGG - Intergenic
976645762 4:87385870-87385892 TTGCCACCGCACACCAGTCCGGG + Intronic
976914847 4:90359959-90359981 TTGCTCCCACACACCAGCCAGGG - Intronic
977152775 4:93533891-93533913 TTGGCTCCCCACTCCATTCAAGG + Intronic
978105915 4:104901691-104901713 TTGTTTCCATTCACCATTCAGGG + Intergenic
980183468 4:129431956-129431978 GTGTGTATACACACCAGTCATGG - Intergenic
980611515 4:135169010-135169032 TAATCACCACACACCAGTAAAGG - Intergenic
983452602 4:167926895-167926917 TAATCTCCACACACCAGCAAAGG + Intergenic
985024437 4:185726108-185726130 CTGCCTCGCCACACCAGTCATGG - Intronic
985757571 5:1728103-1728125 TTGTCTCCATATAGCAGTCCAGG + Intergenic
986241541 5:5964600-5964622 CTTTCTCCACACACCTGTGATGG + Intergenic
987282261 5:16423722-16423744 TAATCGCCACACACCAGTAAAGG + Intergenic
987819194 5:22940297-22940319 TTGTCACCACACTCCAGCCAGGG + Intergenic
989039230 5:37209389-37209411 TTGACTCAACACATCAGCCACGG - Intronic
990862881 5:60347469-60347491 TATTCTCTACACAACAGTCAGGG - Intronic
990979610 5:61590836-61590858 TTGTCTGCACTGACCAGTTAAGG + Intergenic
996191904 5:120554902-120554924 GTGTCTCCACATTCCAGTAAGGG + Intronic
999724984 5:154429717-154429739 CTGGCTCCAGACATCAGTCAAGG - Intergenic
999853976 5:155573303-155573325 TTAACTCCCCACACCAATCATGG + Intergenic
1000700780 5:164446815-164446837 ATGTCTCCACATCCCAGACAAGG + Intergenic
1002096193 5:176832550-176832572 TTCTCACCACACACCACACAGGG - Intronic
1002304952 5:178277811-178277833 ATGTCTCTCCCCACCAGTCATGG - Intronic
1002397192 5:178967179-178967201 GTGACTCTACACATCAGTCAGGG + Intergenic
1004264177 6:14134476-14134498 TTGTCTCCATCCACCAGGCAGGG + Intronic
1004953954 6:20706239-20706261 TTGCCTCCCCATACCAGGCAAGG - Intronic
1010396262 6:75395942-75395964 TTGTTTCCACATCCAAGTCAAGG - Intronic
1014147271 6:118012501-118012523 TTGGGTCCACACACCAAGCATGG - Intronic
1014396335 6:120929174-120929196 TAATCTCCACACACCAGCAAAGG + Intergenic
1018633292 6:165838972-165838994 TTCATTCCATACACCAGTCACGG - Intronic
1021231723 7:18093207-18093229 AAGTCTCCACACACCTGCCAGGG - Intronic
1021545621 7:21810381-21810403 TTGTCTCCATACTCCAGAAAGGG - Intronic
1022293123 7:29022705-29022727 TTGTATGCACACACCATTGAGGG + Intronic
1022312255 7:29208346-29208368 TTGTCTTCACACTCCCGTGAAGG - Intronic
1022403408 7:30063476-30063498 TTTTCTCCACACACGCCTCATGG - Intronic
1023218040 7:37886448-37886470 TTGGCTCCACCCACCACTTACGG + Intronic
1024113897 7:46174026-46174048 TTCCCACCACACACCAGCCATGG + Intergenic
1029128982 7:98315797-98315819 TTCTCTCTGCACACGAGTCAGGG - Intronic
1029500515 7:100926368-100926390 TAATCACCACACACCAGTAAAGG + Intergenic
1029994447 7:104993301-104993323 CTGTCTCTACAAACCAGGCATGG - Intergenic
1030748318 7:113196772-113196794 ATGTTTCCACACACCAGTCAGGG - Intergenic
1030823393 7:114123309-114123331 TTGTCAACACACTCCAGTCTGGG + Intronic
1034922438 7:155095121-155095143 ATGGCTCCAAATACCAGTCACGG - Intergenic
1044632538 8:94293225-94293247 TGGTCACCACACCCCAGACAAGG + Intergenic
1045695637 8:104806017-104806039 ATGTCTCCACACTCCAGCCTGGG - Intronic
1049858119 8:144876619-144876641 CTGTCTCCTCACACCGGACATGG + Intronic
1052751505 9:32496409-32496431 ATGTCTGCACACATCAGTGAGGG - Intronic
1053160325 9:35809509-35809531 ATGTCTGCACACACCAGAAATGG + Exonic
1055583079 9:77728447-77728469 TTGTCTCCAAACCCCAGTGTGGG - Intronic
1057563186 9:96144896-96144918 TTCTCTCCTCTCACCAGTCTTGG + Intergenic
1058458743 9:105162962-105162984 TATTCTCCACGCAGCAGTCAGGG - Intergenic
1058459125 9:105166441-105166463 TTGTGTGCACACACCACACATGG - Intergenic
1058528738 9:105885478-105885500 TTATATCCTCCCACCAGTCATGG - Intergenic
1059071511 9:111142227-111142249 AAGTTTCCAGACACCAGTCAAGG + Intergenic
1060197284 9:121631925-121631947 GTCTCTCCACACACCAACCAGGG - Intronic
1061940889 9:133883177-133883199 CTGTCCCCACACACCACTCCTGG + Intronic
1062560612 9:137139995-137140017 ACGTCTACACACACCAGTCAGGG - Intronic
1186867587 X:13735261-13735283 TTGACTCAACACATCAGCCACGG - Exonic
1190928787 X:54931282-54931304 CTTTGTCCACACAGCAGTCAAGG + Exonic
1194308277 X:92274779-92274801 TTATCGCCACACACCAGCAAAGG - Intronic
1194502715 X:94700529-94700551 TTATCGCCACACACCAGCAAAGG - Intergenic
1196388347 X:115183649-115183671 ATGTCACTACACACCAGTCTGGG + Intronic