ID: 1077779893

View in Genome Browser
Species Human (GRCh38)
Location 11:5315662-5315684
Sequence GCGGCTCCTTTTTTGCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 102}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077779893_1077779895 -4 Left 1077779893 11:5315662-5315684 CCAGGCAGCAAAAAAGGAGCCGC 0: 1
1: 0
2: 0
3: 7
4: 102
Right 1077779895 11:5315681-5315703 CCGCATTGTGTGTTCACAAGTGG 0: 1
1: 0
2: 0
3: 3
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077779893 Original CRISPR GCGGCTCCTTTTTTGCTGCC TGG (reversed) Intronic