ID: 1077780458

View in Genome Browser
Species Human (GRCh38)
Location 11:5323215-5323237
Sequence GACTTAAGTACTTTACCATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 101}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077780458 Original CRISPR GACTTAAGTACTTTACCATA GGG (reversed) Intronic
902056119 1:13601814-13601836 AACGTAAGTACAATACCATAAGG + Intronic
907166758 1:52418980-52419002 GACTTAAAAGCTTTGCCATAGGG + Exonic
910155953 1:84219586-84219608 GAATTAAGTACTTAAAAATAAGG - Intronic
910190424 1:84589341-84589363 AAGGTAAGTACCTTACCATATGG - Intergenic
910595995 1:88981473-88981495 TACTTAAGTAATTGACCAAATGG - Exonic
911799493 1:102117729-102117751 AACTAAAGTACTTTAGTATAGGG - Intergenic
916926947 1:169531713-169531735 CATTTAAGTCCTTTACCATCTGG - Intronic
917246986 1:173014098-173014120 GACTTAAACACTTTCTCATAAGG - Intergenic
917691399 1:177473227-177473249 GACTTTATTACTAGACCATAAGG - Intergenic
920223114 1:204418763-204418785 GACTTTAGTACTTTATCTTTAGG - Intergenic
922772401 1:228193258-228193280 GTCTTAATTACTGTACCATAAGG + Intergenic
1075306162 10:121369422-121369444 AATTTAAGTAATTTCCCATATGG - Intergenic
1075306658 10:121374014-121374036 AACTTTAGTATTTTACCATGAGG + Intergenic
1076243926 10:128931817-128931839 GATTTAAGTTCTTTACCTTAAGG + Intergenic
1077730863 11:4728191-4728213 GACCTGAGTAATTTAACATAGGG + Intronic
1077780458 11:5323215-5323237 GACTTAAGTACTTTACCATAGGG - Intronic
1079808732 11:24968278-24968300 GAATTCAGTAGTTAACCATATGG - Intronic
1081309851 11:41556589-41556611 AACTTAGGTAGTTAACCATATGG - Intergenic
1092994843 12:13940147-13940169 GACTTAAATATTTTGCAATAGGG + Intronic
1098601647 12:72338491-72338513 GACAGAAGTACTTTGCCAAAAGG + Intronic
1099170127 12:79354110-79354132 GAATTAAATGCATTACCATAGGG - Intronic
1099170574 12:79359233-79359255 GATTTCAGCCCTTTACCATATGG - Intronic
1100807421 12:98301094-98301116 GTCTTAAGAAGTTTACCATCTGG - Intergenic
1109761131 13:66830632-66830654 GGCTTAAGAATTTTACTATATGG - Intronic
1112987482 13:105469137-105469159 TAGTTAAGTACCATACCATAGGG + Intronic
1117386783 14:55222691-55222713 GATATAAATACTTTATCATAAGG - Intergenic
1120636112 14:86953202-86953224 GACTCATGTACGTTAACATATGG - Intergenic
1121822144 14:96979578-96979600 GACTTAAGCACTTTACAATTAGG - Intergenic
1122100162 14:99402137-99402159 GACTGAAGACCTTTAGCATAGGG - Intronic
1126313963 15:47348330-47348352 GACATTAGTACTTCATCATAGGG + Intronic
1126360726 15:47843000-47843022 GATTTATGAACTTCACCATATGG + Intergenic
1126412533 15:48386849-48386871 GACTTCAGCTCATTACCATATGG - Intergenic
1127992133 15:64127596-64127618 TACTTAAGTACCTTATCTTAGGG + Intronic
1129805769 15:78455949-78455971 GGCTTCAGTTCTTTTCCATAAGG + Intronic
1130611219 15:85362902-85362924 GACTTAAGTGCATTAGCAGAAGG + Intergenic
1132957238 16:2601021-2601043 GTCTTAAGTATTTTACAGTAGGG - Exonic
1134434314 16:14241723-14241745 GATTTAAGTACTTCACAATCAGG - Intronic
1137905481 16:52317878-52317900 GAGTTAAATACTTAACCATTGGG + Intergenic
1138437596 16:57013159-57013181 AATTTAAGTCCTTTACCAAAGGG + Intronic
1139457822 16:67096496-67096518 CTATTAAGTAATTTACCATAAGG + Intronic
1147027213 17:37597154-37597176 GACCTCAGTACCTTACCACATGG - Intronic
1155206735 18:23564827-23564849 GAGTTAATTTCTTTAACATATGG + Intronic
1155949778 18:31899254-31899276 AACTGAAGTAATTGACCATATGG - Intronic
1156608006 18:38691539-38691561 GCCTTAATTGCTTTACCTTATGG - Intergenic
1157121937 18:44919200-44919222 GAATTAAGGAATTAACCATAGGG + Intronic
927952079 2:27177916-27177938 GACTTTAGTCCTGTACCATTCGG + Intergenic
932072832 2:68637737-68637759 GACTTTAGTTCCTTACCATGTGG - Intergenic
935245123 2:101212301-101212323 GGCTTAAGTACTATATTATATGG + Intronic
938991590 2:136635368-136635390 GGCTTCAGTTCTTTGCCATATGG + Intergenic
939575856 2:143893717-143893739 GACTTAATTGATTTACCAAATGG + Intergenic
940057451 2:149527687-149527709 GACTTCAGTTCTTAGCCATAGGG + Intergenic
943931074 2:193854123-193854145 GACTCAAGGACTTGATCATATGG + Intergenic
1169626417 20:7575681-7575703 GAATTAAGTACGTAACCATAAGG + Intergenic
1173137882 20:40456523-40456545 GATATATGTACTTTTCCATATGG + Intergenic
1173597775 20:44270707-44270729 GACTTTAGTTCCTTACCATGTGG + Intronic
1174672708 20:52322934-52322956 GACTTAACCACCTGACCATATGG + Intergenic
1178108045 21:29342936-29342958 TCCTTTAGTAGTTTACCATAAGG + Exonic
1183550728 22:38482497-38482519 GACTTAACTTCTTTCCCTTAAGG - Intronic
951330296 3:21359596-21359618 GACTTTACTACTATACCATATGG + Intergenic
951934411 3:28005748-28005770 TACTTAAGTATTTTATCATTTGG - Intergenic
958687500 3:97418958-97418980 GACTTCATTACTTTCCAATAAGG - Intronic
961397353 3:126604802-126604824 GACTTCAGTTCTTCACCATATGG + Intronic
963725316 3:148913757-148913779 CACTTAAGTACTTTTTCCTAAGG + Intergenic
970337928 4:15071395-15071417 TACTTAAGAACTTTTACATAGGG + Intergenic
971624816 4:28905759-28905781 TATTTAAGTAAATTACCATAAGG - Intergenic
977189538 4:93982460-93982482 GATTTATGTTCTTTACCCTAGGG - Intergenic
977800232 4:101219968-101219990 AAGTTAAGTACTTAATCATAAGG + Intronic
978594529 4:110362429-110362451 CACTTTAATACTGTACCATAAGG + Intergenic
978830233 4:113075320-113075342 CACATAAGTACATTACTATATGG - Intronic
979711231 4:123781851-123781873 GACTTAAGGAATGTACCAGAAGG + Intergenic
981806248 4:148718668-148718690 GACTTCATTTCTTCACCATATGG - Intergenic
981908153 4:149946977-149946999 GACTTAAGTACTAGCCAATAAGG + Intergenic
984786803 4:183574617-183574639 GGCCTTAGTTCTTTACCATATGG - Intergenic
987061128 5:14244981-14245003 GAGTTAAGTACTTGAACATCGGG + Intronic
989685937 5:44087372-44087394 GACTGAATTCCTTTACAATATGG - Intergenic
991134937 5:63170665-63170687 GACTCAAGTTCCCTACCATATGG + Intergenic
991421002 5:66441804-66441826 GACGTAAGTACTTTAATATTAGG + Intergenic
992842587 5:80710962-80710984 GACAGAAGTACTTTCCCATCAGG + Intronic
994706800 5:103216786-103216808 AATTTAAGTGCTTTACAATAAGG - Intergenic
994867238 5:105291120-105291142 GTCTTAAGTAGTTTACTAGATGG + Intergenic
1005178804 6:23079801-23079823 GCCTGAAGTAATTTACCATGGGG - Intergenic
1013327085 6:109057034-109057056 GAATTCAGTTCCTTACCATAGGG - Intronic
1013435937 6:110106947-110106969 GACTTCAGTATTTAACTATATGG + Intronic
1014635261 6:123838235-123838257 GACTTAAGGACTTTGGCTTATGG - Intronic
1015033721 6:128627270-128627292 GACATAAGCATTATACCATATGG - Intergenic
1023510665 7:40949858-40949880 GACTTCGATACTATACCATAAGG - Intergenic
1027430797 7:78110602-78110624 GAATTAAGTACTTCTCCATATGG - Intronic
1028307660 7:89286199-89286221 GACTTTAGGACTTTATCATTAGG + Intronic
1028527005 7:91797631-91797653 GTCTCCATTACTTTACCATAGGG - Intronic
1033192838 7:139297887-139297909 CACATAAGTACTTTCCCATCAGG - Exonic
1038563716 8:28602013-28602035 GACTCATGTACATTACCACATGG - Intronic
1038674369 8:29610090-29610112 TTCTTAAGTACATTTCCATATGG - Intergenic
1041418370 8:57639254-57639276 GATTTACGTACTTTATTATATGG - Intergenic
1041789801 8:61681794-61681816 GGCTTTAGTGCTTTATCATAAGG + Intronic
1042505221 8:69552194-69552216 GAATTAAGTACTTGAGCCTAGGG + Intronic
1042610387 8:70593158-70593180 AACTTAAGTACCATAGCATATGG + Intronic
1043684469 8:83069059-83069081 GACTTAACTCCTTTAGCACAAGG + Intergenic
1044118080 8:88359029-88359051 TACTGAAGCATTTTACCATATGG - Intergenic
1049945246 9:588825-588847 TTCTAAAGTACTTTACCAGAGGG - Intronic
1050766118 9:9136301-9136323 GGCTTAATTACTTTATTATAAGG + Intronic
1051169757 9:14308748-14308770 GAATTAAGTAGTTTACCTTTAGG + Intronic
1052468843 9:28866604-28866626 GACTTAAGTGCTACACAATATGG + Intergenic
1055228234 9:74027641-74027663 GACTTAACTGCATTACCCTAGGG - Intergenic
1059982644 9:119790120-119790142 GAATTAAGTAACTTACCCTAAGG + Intergenic
1061528531 9:131190244-131190266 GACTTGAGTATTTTACAAAAAGG + Intronic
1189113386 X:38317677-38317699 GACTTAAGTGATTTACAATCAGG - Intronic
1195121969 X:101763827-101763849 GAGTTAAGTACCTTACCTTTTGG - Intergenic
1195318475 X:103701444-103701466 GACTTAAGCACTTTACCAGCCGG + Intergenic
1195830520 X:109053433-109053455 GACTTTAGTAGTTTTCCTTATGG + Intergenic
1196038606 X:111175279-111175301 TACTTAAGTACATTTCCATTTGG - Intronic