ID: 1077781149

View in Genome Browser
Species Human (GRCh38)
Location 11:5330993-5331015
Sequence ATGGCCCATGACTGTTTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 129}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077781149_1077781156 27 Left 1077781149 11:5330993-5331015 CCAATAAAACAGTCATGGGCCAT 0: 1
1: 0
2: 2
3: 13
4: 129
Right 1077781156 11:5331043-5331065 AGAGAGGGAGTGGATTAGATAGG 0: 1
1: 0
2: 1
3: 35
4: 347
1077781149_1077781153 12 Left 1077781149 11:5330993-5331015 CCAATAAAACAGTCATGGGCCAT 0: 1
1: 0
2: 2
3: 13
4: 129
Right 1077781153 11:5331028-5331050 TCTGGACTCCACGATAGAGAGGG 0: 1
1: 0
2: 1
3: 4
4: 73
1077781149_1077781154 17 Left 1077781149 11:5330993-5331015 CCAATAAAACAGTCATGGGCCAT 0: 1
1: 0
2: 2
3: 13
4: 129
Right 1077781154 11:5331033-5331055 ACTCCACGATAGAGAGGGAGTGG 0: 1
1: 0
2: 0
3: 8
4: 115
1077781149_1077781152 11 Left 1077781149 11:5330993-5331015 CCAATAAAACAGTCATGGGCCAT 0: 1
1: 0
2: 2
3: 13
4: 129
Right 1077781152 11:5331027-5331049 CTCTGGACTCCACGATAGAGAGG 0: 1
1: 0
2: 0
3: 2
4: 54
1077781149_1077781150 -6 Left 1077781149 11:5330993-5331015 CCAATAAAACAGTCATGGGCCAT 0: 1
1: 0
2: 2
3: 13
4: 129
Right 1077781150 11:5331010-5331032 GGCCATGATGAGCAACACTCTGG 0: 1
1: 0
2: 0
3: 8
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077781149 Original CRISPR ATGGCCCATGACTGTTTTAT TGG (reversed) Intronic
902752230 1:18524982-18525004 ATGGCCCATGATACTTTTAGGGG - Intergenic
902830679 1:19010403-19010425 ATGGCCCAGGACTGTCTGATGGG + Intergenic
903809291 1:26025920-26025942 AGGGCCCATGATACTTTTATAGG + Intronic
905999390 1:42411031-42411053 CTGGCCCATGTCTTCTTTATGGG - Intronic
910140454 1:84021556-84021578 ATGGCCTATATCTGTTTTCTGGG - Intergenic
911902495 1:103524016-103524038 ATGTCCCATGACTCCATTATGGG + Intergenic
923978225 1:239289123-239289145 ATTGCACATGACTGTTCTAATGG + Intergenic
1065492466 10:26295711-26295733 GTGCCCAATGGCTGTTTTATGGG + Intronic
1067692402 10:48510229-48510251 ATAGCACAGAACTGTTTTATGGG - Intronic
1070121737 10:73584071-73584093 ATGGACCAAGATTGATTTATAGG + Intronic
1071586044 10:86822441-86822463 ATTGCCCATGACTGTGATAATGG - Intronic
1072524722 10:96261394-96261416 ATTGCCAATGACTGCTTCATGGG - Intronic
1075786587 10:125054024-125054046 ATGGCCCTCTACTGTTTTGTGGG - Intronic
1075975263 10:126688849-126688871 ATGGACAGTTACTGTTTTATGGG + Intergenic
1077781149 11:5330993-5331015 ATGGCCCATGACTGTTTTATTGG - Intronic
1078502333 11:11892971-11892993 ATGGGCCATGCTTATTTTATGGG + Intronic
1078671891 11:13373066-13373088 ATGGCCAACGAGTATTTTATTGG - Intronic
1079176001 11:18141138-18141160 CCGGCCCATGACTATTTTTTAGG + Intronic
1083614610 11:64020019-64020041 AGGGCCCATGACACTTTTAGGGG + Intronic
1086962369 11:92991584-92991606 CTGGCCCTTGACTGTTATCTGGG - Intergenic
1088285947 11:108187882-108187904 ATGGCATATCACTGTTTCATGGG - Intronic
1101612854 12:106307650-106307672 ATGGCCCATCACTGTGTGAATGG - Intronic
1101631988 12:106504130-106504152 ATGGAACGTGACTGTTTAATCGG + Exonic
1102537263 12:113590808-113590830 ATGGCTCATGCCTGTATTCTTGG + Intergenic
1108095714 13:46898405-46898427 TTGGCCCATGTCTGGCTTATAGG + Intergenic
1111235453 13:85402232-85402254 ATGGGGCATTACTGTTTCATGGG - Intergenic
1113529938 13:111016394-111016416 ATGGGGCATTACTGTTTAATGGG + Intergenic
1114466769 14:22928800-22928822 ATGTCCCATGGCTGTGTTTTAGG - Intronic
1121902685 14:97708379-97708401 CTGTCCCCTGGCTGTTTTATTGG + Intergenic
1123089856 14:105737703-105737725 ATGGCCCATGGCTGGTGTGTGGG + Intergenic
1124511119 15:30326787-30326809 ATGTCCCAACACTGTTGTATTGG - Intergenic
1124731795 15:32203978-32204000 ATGTCCCAACACTGTTGTATTGG + Intergenic
1127514435 15:59677915-59677937 ATGGCTGATAACTTTTTTATAGG + Exonic
1130678500 15:85975455-85975477 ATAGCTCATGCCTGCTTTATGGG + Intergenic
1135039006 16:19103304-19103326 AGGGTCCATGTCTGTCTTATAGG - Intergenic
1135039213 16:19105005-19105027 CTTGCCTATGAGTGTTTTATGGG - Intergenic
1137251080 16:46741399-46741421 ATGGCTCTGGGCTGTTTTATGGG - Intronic
1139831221 16:69799899-69799921 ATGGCCCATGGCGGTGGTATTGG + Intronic
1140005333 16:71069201-71069223 AGGGCCCATGACTATTTTGAAGG + Intronic
1151288299 17:73129477-73129499 ATAGGTAATGACTGTTTTATGGG + Intergenic
1151381547 17:73729166-73729188 ATGGCCCATGGCTGCCATATTGG - Intergenic
1152444143 17:80330816-80330838 ATGGACCATGTCTTTTTTTTGGG + Intronic
1152555276 17:81049922-81049944 ATGGCCCGTGCCTGTGTTCTAGG + Intronic
1154257875 18:12800126-12800148 ATTGCAGAAGACTGTTTTATGGG - Intronic
1156167398 18:34438907-34438929 ATGGCCCTTGGCTGTTTCTTTGG - Intergenic
1158383199 18:56958799-56958821 ATGACCAATGAATATTTTATAGG - Intronic
1159078276 18:63706224-63706246 ATGACCCATGACATTTATATAGG - Intronic
1164111779 19:22169633-22169655 GTTGCCCATGAATCTTTTATTGG - Intergenic
1165316869 19:35061164-35061186 ACAGCCCAAGACTGTTTCATCGG + Intronic
1168126086 19:54283959-54283981 AAGGGCCATGACTGTTCTGTGGG - Intergenic
928843529 2:35640051-35640073 ATGACCTATGAGAGTTTTATGGG - Intergenic
930049424 2:47203178-47203200 ATGGTGCATGACTGCTTAATGGG + Intergenic
930140996 2:47951396-47951418 ATGGCCAAAGAGAGTTTTATGGG - Intergenic
930184827 2:48403007-48403029 ATCGGCCATGCCAGTTTTATAGG - Intergenic
930966026 2:57327645-57327667 ATGGGCCATGACTGTGTTAGGGG + Intergenic
935108524 2:100069510-100069532 AGGGACTATGACTGTTTTCTAGG - Intronic
936975260 2:118213876-118213898 ATGGGCCAAGAGTTTTTTATGGG - Intergenic
939448790 2:142344524-142344546 ATGGCACATGAGTGTTGAATAGG + Intergenic
941478625 2:165977921-165977943 ATGGCCCATGCCTGTTAGAATGG + Intergenic
943797605 2:192016870-192016892 ATGTCGCATCACTGTTTTTTTGG + Intronic
947246694 2:228056381-228056403 TTGGCCCATGTCTGTGTTTTTGG + Intronic
948067852 2:235094904-235094926 ATGACCCAAGTCTGCTTTATGGG + Intergenic
948077680 2:235178827-235178849 ATAGCCCATTACAGTTTAATGGG - Intergenic
1168788729 20:561776-561798 ATGGCCCATGACCGTGGTCTGGG + Intergenic
1169699829 20:8433549-8433571 ATCTCCCATGCCTGTTTTCTGGG + Intronic
1172983089 20:38959727-38959749 ATCGGCCATGCCTGTATTATTGG - Intergenic
1177004037 21:15648692-15648714 GTGCCCCATGCCTGTTTTCTCGG + Intergenic
1177098651 21:16871717-16871739 AATGTCCATGACTATTTTATAGG - Intergenic
1177864929 21:26500905-26500927 CTGTCCCACTACTGTTTTATAGG - Intronic
1179019635 21:37626755-37626777 ATGGCCCATGATACTTTTAGAGG + Intronic
1182004492 22:26948456-26948478 ATGGGCCATGATTCTATTATGGG - Intergenic
1182793563 22:32973542-32973564 ATGGGCCATGCCTTTTTTGTAGG - Intronic
1183763648 22:39849015-39849037 GTGGCCCAGGTCTGTTTTCTAGG + Intronic
1184632024 22:45789159-45789181 GTGGCCAAAGACTGTTTTAGAGG - Intronic
949924589 3:9031254-9031276 ATGGACCATGGCTCTTTTATGGG + Intronic
951106914 3:18755127-18755149 ATTGTCCATGAATGCTTTATGGG + Intergenic
951539492 3:23768777-23768799 ATGGGACATGACTGTTTAATAGG + Intergenic
952047265 3:29337822-29337844 ATGTCCCCTAACTGTTTTACTGG - Intronic
953867891 3:46599964-46599986 ATGTCCCATGCCCGTTGTATTGG + Intronic
954438455 3:50508546-50508568 ATGGCCCAATGCTGGTTTATGGG - Intergenic
960405719 3:117256865-117256887 ATGAACCATGTCTGATTTATTGG - Intergenic
960420072 3:117434510-117434532 TTGAGCCATAACTGTTTTATTGG - Intergenic
960981533 3:123232548-123232570 CTGGCCCTTTACTGTTTTTTTGG - Intronic
961275749 3:125724894-125724916 ATGGCCTATGACTGCTTTGTAGG + Intergenic
961278670 3:125747489-125747511 ATGGCCTATGACTGCTTTGTAGG + Intergenic
961320025 3:126066400-126066422 ATGAACCATGTGTGTTTTATTGG + Intronic
963047519 3:141113673-141113695 ATGGGACATGACTGCTTAATGGG + Intronic
963570768 3:146992626-146992648 ATGGGGCATTAGTGTTTTATGGG - Intergenic
966005818 3:175010626-175010648 TTGGCCCAAAACTGTTTGATGGG - Intronic
971134806 4:23856702-23856724 AGGGGCCATGCCTGTTTTATAGG - Intronic
973001119 4:44952024-44952046 GTGGCACATGACTGTTTTCTAGG + Intergenic
974540010 4:63221429-63221451 AACGTCCTTGACTGTTTTATTGG + Intergenic
976091446 4:81461944-81461966 GTGACCCATGACCGTTTTGTGGG - Intronic
978642626 4:110889513-110889535 ATGGCTCATGACTGGTCTAATGG + Intergenic
979069978 4:116190281-116190303 ATTCCCCAAAACTGTTTTATTGG + Intergenic
979374674 4:119932230-119932252 ATGGTGAATGACTGTTTTTTAGG - Intergenic
979526559 4:121723908-121723930 ATGGCCTTTTACTGTTTTTTTGG - Intergenic
983811932 4:172073530-172073552 TTGACCCATGAATGTTTTATGGG - Intronic
986374688 5:7118115-7118137 TTGGCCCATTACAGTGTTATTGG + Intergenic
987936138 5:24466932-24466954 ATGGCCCATGAATGTTTTTTGGG + Intergenic
989119965 5:37995157-37995179 ATGGCACATGGCTGCTTGATAGG + Intergenic
990849014 5:60180165-60180187 ATGTCACATGACTGTTTTAGTGG - Intronic
992800337 5:80289820-80289842 ATGACCTCTGAATGTTTTATTGG - Intergenic
993704962 5:91159444-91159466 GAAGTCCATGACTGTTTTATGGG - Intronic
997023602 5:130031548-130031570 ATTACCAATGACAGTTTTATTGG - Intronic
1000568866 5:162885260-162885282 ATTGGCCATGACAGTTTTTTTGG - Intergenic
1000916773 5:167092284-167092306 ATGGCCCGTGACTGCTTTTAAGG + Intergenic
1000999844 5:167995181-167995203 ATGGCTCCTGCCTGATTTATGGG + Intronic
1002887500 6:1310362-1310384 AGGGCACATGACTATTTGATGGG - Intergenic
1003367002 6:5484547-5484569 ATAGCCACTGACTGCTTTATTGG + Intronic
1004798656 6:19118880-19118902 ATGGCGAATGATTCTTTTATGGG - Intergenic
1012008863 6:93754275-93754297 ATGGCCCATGTCTGACTAATTGG - Intergenic
1013632407 6:111998103-111998125 ATGGCCCATGACTTTGCTGTTGG + Intergenic
1020745389 7:12072839-12072861 ATGGCCCATGACTCTCGTGTGGG - Intergenic
1020902460 7:14022321-14022343 ATGAGCTATGACTGTTTTATAGG - Intergenic
1021826411 7:24556974-24556996 ATGGCCAATGAATGCTTTTTTGG - Intergenic
1023140600 7:37098286-37098308 AGGGCCCTTGTCTATTTTATGGG - Intronic
1023372025 7:39521184-39521206 ATGGGCATTGACTGTCTTATAGG - Intergenic
1024739800 7:52341571-52341593 ATGTCCCTTGATTGTTTTGTGGG - Intergenic
1024828821 7:53424170-53424192 ATTGCCCATTACTTTTTTACTGG + Intergenic
1029039440 7:97557222-97557244 CTGGCCCATGAGTGTTCTACAGG + Intergenic
1030840762 7:114351174-114351196 ATGGCCCATGTCTGTTGCAATGG + Intronic
1031040954 7:116838059-116838081 AGGGCCCATGACACTTTTAGGGG + Intronic
1033267392 7:139897850-139897872 ATGGCCTATGACTGTGTCACTGG + Intronic
1039626468 8:39059635-39059657 ATGGCCCATGACTGGGTTGTAGG - Intronic
1043642324 8:82470683-82470705 ATGGAGAATGACTGTTTAATGGG + Intergenic
1044771637 8:95641892-95641914 ATGGGCAATGACTGCTTAATGGG - Intergenic
1044850792 8:96425324-96425346 ATGGCCCAACACTGTTTCACTGG + Intergenic
1046859356 8:119072640-119072662 ATGGCACCTCAGTGTTTTATGGG + Intronic
1050809681 9:9728272-9728294 ATGTCCCATGAATATTTTAGAGG + Intronic
1053442622 9:38128553-38128575 CTGCCCCATGACTGTGTTTTGGG + Intergenic
1056267896 9:84917803-84917825 CTGGCGCCTGACTGTTTTGTTGG - Intronic
1057529450 9:95831297-95831319 ATGGCCCATGAAGGCTTTAGTGG + Intergenic
1059026135 9:110633257-110633279 AGGGCCCATGACCTTTTTTTCGG - Intergenic
1186207769 X:7217773-7217795 ATGGCCCATGAAAGTCTTACTGG - Intergenic
1187251728 X:17604930-17604952 ATTGCCCTTGAATGTTTTATTGG - Intronic
1189366230 X:40390950-40390972 ATGGCCCATTACATTTTTAGGGG - Intergenic
1191127869 X:56976791-56976813 ATGGCCCATGACTGTTTCACTGG + Intronic
1192167207 X:68833505-68833527 ATGGTGCATCACTGTTTTCTGGG + Intronic
1194314678 X:92361800-92361822 ATGGGGCATCACTGTTTCATGGG - Intronic
1196389897 X:115196207-115196229 ATGGCTCATGGCTGAATTATGGG + Intronic
1198405401 X:136307054-136307076 ATGTCCCATGATTTATTTATTGG + Intronic
1200622733 Y:5473317-5473339 ATGGGGCATCACTGTTTCATGGG - Intronic
1200698281 Y:6380470-6380492 ATGGCCCCTGGCTGTCATATTGG + Intergenic
1201035833 Y:9784229-9784251 ATGGCCCCTGGCTGTCATATTGG - Intergenic