ID: 1077782664

View in Genome Browser
Species Human (GRCh38)
Location 11:5348533-5348555
Sequence AATTAAGCTTGGACGGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 62}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077782660_1077782664 2 Left 1077782660 11:5348508-5348530 CCATATGACTAATAAACCAATTC 0: 1
1: 0
2: 3
3: 17
4: 153
Right 1077782664 11:5348533-5348555 AATTAAGCTTGGACGGAGCTTGG 0: 1
1: 0
2: 0
3: 3
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077782664 Original CRISPR AATTAAGCTTGGACGGAGCT TGG Intronic
902627511 1:17685072-17685094 ATTTGAGCTGGGAAGGAGCTGGG + Intronic
904400370 1:30252768-30252790 ATTTCAGCTTGGACGCAGCATGG - Intergenic
904733100 1:32609842-32609864 AATTGAGCTTTTACAGAGCTTGG - Intronic
907560824 1:55385917-55385939 AATAAAGCATGGAAGGAGATAGG + Intergenic
908376886 1:63552057-63552079 AATTAAGGATGGGAGGAGCTGGG + Intronic
908903844 1:68985646-68985668 AATCAAGCTTGGATGGAGAGAGG + Intergenic
911005299 1:93214965-93214987 AAGTAAGCTTGGAATTAGCTTGG + Exonic
914871058 1:151474084-151474106 AATTAAACCTGGGCTGAGCTAGG - Intergenic
917628336 1:176868351-176868373 CATCAATCTTGGCCGGAGCTAGG - Intronic
1074189792 10:111125690-111125712 TATTAAGGGTGGACGGGGCTTGG + Intergenic
1075121810 10:119669930-119669952 AATGTAGCCTGGTCGGAGCTGGG - Exonic
1077782664 11:5348533-5348555 AATTAAGCTTGGACGGAGCTTGG + Intronic
1088834227 11:113564164-113564186 TATTAAGCATGGACAGGGCTTGG + Intergenic
1092236519 12:6814137-6814159 CATTCAGCTTGGATGGACCTGGG - Exonic
1102668139 12:114593803-114593825 AATATAGTTTGGACAGAGCTGGG - Intergenic
1121309506 14:92928027-92928049 CATCAAGCCTGGAAGGAGCTGGG - Intronic
1127881276 15:63160388-63160410 TGTTAAGCTTTGACAGAGCTAGG - Intergenic
1131295254 15:91142422-91142444 ATTTAGGCTTGGAGGGAGATAGG - Intronic
1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG + Exonic
1136158937 16:28404991-28405013 TATTAAGTTTTGACGGTGCTGGG - Intergenic
1136204151 16:28710292-28710314 TATTAAGTTTTGACGGTGCTGGG + Intronic
1137761905 16:50947951-50947973 AAGTCAGCTTGCAAGGAGCTTGG + Intergenic
1138329610 16:56203126-56203148 GATTAAGCTGGGAGGGAACTGGG + Intronic
1139251184 16:65498103-65498125 AATGAAGCTAGGAAGGTGCTGGG + Intergenic
1140552202 16:75878778-75878800 AATTAATCTGGGTTGGAGCTAGG - Intergenic
1140896576 16:79330219-79330241 AATTATGCTTGGAATGATCTGGG - Intergenic
1156590463 18:38482266-38482288 AATAAAGCTTGTAAGGAGTTAGG + Intergenic
1158694933 18:59696019-59696041 AACTAAGCGTGGATGGGGCTAGG - Intronic
1158881018 18:61779715-61779737 ATTGAAGCTGGGATGGAGCTGGG - Intergenic
928596233 2:32861829-32861851 AATTAACCTGGGGAGGAGCTGGG + Intergenic
933940208 2:87238929-87238951 AAGTAGGTTTGGAGGGAGCTGGG + Intergenic
936033493 2:109090616-109090638 AATCAAGATTGGACAGAACTGGG - Intergenic
936352930 2:111726847-111726869 AAGTAGGTTTGGAGGGAGCTGGG - Intergenic
938122429 2:128643448-128643470 ACTTGAGCATGGAAGGAGCTAGG - Intergenic
940357566 2:152762198-152762220 AATTAAGATGTGACGAAGCTGGG + Intergenic
946786631 2:223252032-223252054 CATTAAGCTAGGAAGAAGCTGGG - Intergenic
1168768664 20:399486-399508 CACTCAGCTTGGAGGGAGCTGGG - Intergenic
1170877817 20:20267341-20267363 AGTTAAACTTGGACGTGGCTGGG - Intronic
1175782189 20:61689831-61689853 AATTGAGCTGGGACGGTGGTTGG + Intronic
1175782203 20:61689903-61689925 AATTGAGCTGGGACGGTGGTTGG + Intronic
1176931860 21:14822850-14822872 AAATAAGCTTGGACACAGATTGG - Intergenic
953448338 3:42986567-42986589 AATTTGGCTGGGAAGGAGCTGGG + Intronic
964490657 3:157232435-157232457 AAGTAGGATTGGATGGAGCTTGG + Intergenic
965746398 3:171930295-171930317 AATTATCCTGGGAAGGAGCTTGG + Intronic
967649502 3:191968578-191968600 AATTTAGTTTGGACTCAGCTAGG + Intergenic
968264704 3:197354019-197354041 AAGTAAGCTTAGATGGAGCCTGG + Intergenic
970495973 4:16626595-16626617 AATGAAGCTTAGCCAGAGCTGGG - Intronic
972711279 4:41597612-41597634 ACATGAGCTTGGAAGGAGCTTGG - Intronic
972750784 4:41986559-41986581 AATTAAGCTGAGACAGAGCATGG - Intergenic
974809213 4:66923657-66923679 ATTTAAGCTTGGAAAGAGCTTGG - Intergenic
974970009 4:68811428-68811450 AATTCAGCTAGAACTGAGCTGGG + Intergenic
975855056 4:78615326-78615348 AATAAAGGTTGGAAGGAGTTTGG - Intergenic
976971494 4:91107827-91107849 AATTAAGGTTGGGCAGTGCTGGG + Intronic
982993953 4:162317257-162317279 AAGCAACCTTGGACTGAGCTAGG + Intergenic
983314769 4:166117304-166117326 AATTAACCTTGGTCGGGGCAAGG - Intergenic
984559761 4:181254605-181254627 AAATGAGCTGGGACGGAGCTCGG + Intergenic
985422249 4:189795890-189795912 AATTAGACTGGGCCGGAGCTTGG + Intergenic
990726434 5:58760071-58760093 AAATAAGGGTGGACGGAACTAGG - Intronic
1000198657 5:158986134-158986156 AATTAAGCTGGGAAGGAGACAGG - Intronic
1002361447 5:178674617-178674639 AATGAAGCTAAGACAGAGCTTGG - Intergenic
1007460478 6:42014627-42014649 AAATAAGATGGGAAGGAGCTGGG + Intronic
1013366873 6:109443552-109443574 AAGGAGGCCTGGACGGAGCTGGG + Exonic
1033596000 7:142858231-142858253 AAATAAGCTTGGAGGAAGGTAGG - Intronic
1056503146 9:87230561-87230583 AATTCAGCTTAGAAGGAGGTAGG - Intergenic
1062474482 9:136720405-136720427 AAGCAGGCTTGGAGGGAGCTGGG - Intronic
1192140278 X:68641372-68641394 AAGTAAACTTGGACAGAACTTGG - Intergenic