ID: 1077789636

View in Genome Browser
Species Human (GRCh38)
Location 11:5424511-5424533
Sequence CTGTGTACTGGGAGGATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 365}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077789636_1077789647 28 Left 1077789636 11:5424511-5424533 CCCTCCATCCTCCCAGTACACAG 0: 1
1: 0
2: 4
3: 33
4: 365
Right 1077789647 11:5424562-5424584 GGAAAAGGCAGGCTTCATCCAGG 0: 1
1: 6
2: 15
3: 47
4: 292
1077789636_1077789645 13 Left 1077789636 11:5424511-5424533 CCCTCCATCCTCCCAGTACACAG 0: 1
1: 0
2: 4
3: 33
4: 365
Right 1077789645 11:5424547-5424569 AGAAAGAATCAGTCAGGAAAAGG 0: 13
1: 23
2: 35
3: 114
4: 692
1077789636_1077789644 7 Left 1077789636 11:5424511-5424533 CCCTCCATCCTCCCAGTACACAG 0: 1
1: 0
2: 4
3: 33
4: 365
Right 1077789644 11:5424541-5424563 TTATTCAGAAAGAATCAGTCAGG 0: 17
1: 36
2: 113
3: 138
4: 369
1077789636_1077789646 17 Left 1077789636 11:5424511-5424533 CCCTCCATCCTCCCAGTACACAG 0: 1
1: 0
2: 4
3: 33
4: 365
Right 1077789646 11:5424551-5424573 AGAATCAGTCAGGAAAAGGCAGG 0: 1
1: 8
2: 27
3: 70
4: 429

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077789636 Original CRISPR CTGTGTACTGGGAGGATGGA GGG (reversed) Intronic
900493417 1:2964731-2964753 GTGTATAGTGGGTGGATGGATGG - Intergenic
901061788 1:6475132-6475154 TTGGGTCCTGGGAGGATGGTGGG + Exonic
902111046 1:14078639-14078661 CTGTGTCCTCACAGGATGGAAGG + Intergenic
902237682 1:15068256-15068278 CTGGGTTCTGGGAGGGGGGATGG + Intronic
902792331 1:18777847-18777869 CTGTGTTCTGGGAGCTTGCAAGG + Intergenic
902979690 1:20113907-20113929 CTGTGTCCTCTGAGGGTGGATGG - Exonic
903974862 1:27142814-27142836 CTGTGTCCTGAGAGAAGGGAAGG - Intronic
904680434 1:32225306-32225328 CTGGGTACTGGGGACATGGAGGG + Intronic
904801951 1:33099283-33099305 CTGGGTACCTGGAGGAAGGAGGG - Intronic
905034865 1:34911462-34911484 CTGTGTCCTGGGATAGTGGATGG - Intronic
905264204 1:36739890-36739912 CAGTGTACTTGAAGGAAGGAAGG + Intergenic
905773757 1:40654937-40654959 CTGGGCACCAGGAGGATGGAGGG - Intronic
907593095 1:55694376-55694398 CTGTAGAGTGGGAGGTTGGATGG + Intergenic
908041597 1:60119568-60119590 CTGTCTACTGGTAGGATTGAGGG - Intergenic
911454669 1:98108283-98108305 CAGTAAAGTGGGAGGATGGAAGG + Intergenic
912442793 1:109712111-109712133 CTGGGGACTGGGAGGCGGGAGGG + Intergenic
912490337 1:110059299-110059321 GTGTTTACTGGGAGGGTGGGAGG + Intronic
913341324 1:117760429-117760451 TTTTTTACTGGGAGGAGGGAAGG - Intergenic
914382382 1:147128809-147128831 CAGTGTAGTTGGAGGATGGTGGG - Intergenic
915930926 1:160060638-160060660 CTGGGGCCTGGGAGGGTGGATGG - Intronic
916046316 1:161002383-161002405 GTGTGTGCTGGGTGGAGGGAGGG + Intronic
916173349 1:162018606-162018628 CTCTGTACTGGCAGGCAGGATGG - Intronic
918916064 1:190639427-190639449 ATGTGCACTTGGAGGGTGGAGGG + Intergenic
920113162 1:203601180-203601202 GTGTGGACTTGGGGGATGGATGG - Intergenic
920417542 1:205808883-205808905 CTGTGTCCTGGGAGACTGAAGGG - Intronic
920434819 1:205940924-205940946 CTGTGTTCTGGGAAGAGGAAAGG + Intronic
922127062 1:222738038-222738060 GTGTGTGTTGGGGGGATGGAGGG + Intronic
922218205 1:223538133-223538155 CTGTGTCCTGGAAGGGTAGAAGG + Intronic
922700596 1:227757748-227757770 CTGTCTACAGTCAGGATGGAAGG + Intronic
1063350813 10:5352937-5352959 CTGTGTGTGGGGAGGATGGAGGG - Intergenic
1064390002 10:14934001-14934023 AGGTGAGCTGGGAGGATGGAAGG + Intronic
1064400437 10:15016529-15016551 AGGTGAGCTGGGAGGATGGAAGG + Intergenic
1064623801 10:17241730-17241752 CTGTGTCCTCGCATGATGGAAGG - Intergenic
1064847352 10:19670225-19670247 ATGTGGAGTGGGAGGATTGAGGG - Intronic
1066623770 10:37385250-37385272 TAGTGTACTGGGAGGGTGAATGG + Intergenic
1068120916 10:52781141-52781163 ATTTGTCCTGGGAGGATTGAGGG + Intergenic
1068754017 10:60630595-60630617 CAGTGATCTGGGAGGAAGGAAGG + Intronic
1069785347 10:70984250-70984272 AAGTGTCCTAGGAGGATGGAGGG - Intergenic
1070713443 10:78700288-78700310 TTGTGTACTGGGGGGGTGGGAGG - Intergenic
1071215374 10:83394405-83394427 CTGTGTGCTGGGAAGAGAGAGGG - Intergenic
1071502088 10:86211426-86211448 CTGTGTCCTGGGAAAGTGGAGGG + Intronic
1071755154 10:88529139-88529161 CTGAGGAGTGGGAGGAGGGATGG - Intronic
1072208025 10:93221608-93221630 CTAGGGACTGGGAGGAGGGACGG - Intergenic
1072791774 10:98323059-98323081 ATGTGTACTGGGTGGAAGCATGG + Intergenic
1073112737 10:101072230-101072252 CTGTGTCCTGGGAGGAGGCAAGG + Intergenic
1073991704 10:109268815-109268837 CTGAGGAGTGGGAGGATGGTAGG + Intergenic
1074397102 10:113107246-113107268 CTGGGTACTGGGTGGGTGGGTGG + Intronic
1074558407 10:114513054-114513076 CTGGGGAAAGGGAGGATGGATGG - Intronic
1076705747 10:132300659-132300681 CTGTATACTGGGAGAGGGGAGGG + Intronic
1077048715 11:557187-557209 CTGGGTACTGGGAGGCAAGAGGG - Intronic
1077101799 11:825789-825811 CTGTGTACTGGCAGGAGGCTGGG - Intergenic
1077310298 11:1885716-1885738 GTGAGTACTGGGTGGATGGAGGG - Intronic
1077472209 11:2769384-2769406 CTGTGAGTTGGGAGGATGGAGGG + Intronic
1077789636 11:5424511-5424533 CTGTGTACTGGGAGGATGGAGGG - Intronic
1078572700 11:12473347-12473369 CTGTGTGCTGACAGGATGAATGG - Intronic
1079005108 11:16786092-16786114 GTGTGGCCTAGGAGGATGGATGG - Intronic
1080440209 11:32287377-32287399 CTGTTTACTAGGAGTAAGGATGG + Intergenic
1080739025 11:35046808-35046830 CTGTGTCCTCACAGGATGGAAGG + Intergenic
1081881379 11:46455826-46455848 CAGTGTCATGGGAGGAAGGAAGG - Intronic
1082802179 11:57423191-57423213 CTGTGTAATGGGTGGAAGGGTGG + Intronic
1084646990 11:70464498-70464520 CTGTGTTCTGGGCGGATGCTTGG - Intergenic
1084680440 11:70663404-70663426 CTGTAAAATGGGAGGATCGAGGG - Intronic
1084967714 11:72752991-72753013 GTATGTGCTGGGAGGATGGGTGG - Intronic
1085120431 11:73964189-73964211 CTTTGCACTGGGAGGAAGGATGG + Intronic
1085805450 11:79631959-79631981 CTTTGGACTGGAAGGAAGGAAGG + Intergenic
1086447932 11:86887692-86887714 CGGTGTACTGGGAGTAGGGGTGG + Intronic
1086937453 11:92760461-92760483 ATATGTACTTGGAGGCTGGAAGG - Intronic
1090062362 11:123475162-123475184 CTGGGTACAGGGAGGGAGGAAGG + Intergenic
1090073595 11:123564685-123564707 CTGTTTGATGGGTGGATGGATGG + Intronic
1090396664 11:126423872-126423894 TGGTGTACTGGGGGGAGGGAGGG - Exonic
1092138451 12:6166418-6166440 CTGTGGAGAGGGAGCATGGAAGG - Intergenic
1092880990 12:12887882-12887904 TTTTTTACTGGCAGGATGGAAGG - Intergenic
1092968903 12:13672578-13672600 CTGTGGGCAGGGAGGATGGCAGG - Intronic
1093069423 12:14693157-14693179 CTCATTCCTGGGAGGATGGATGG + Intronic
1093078651 12:14784131-14784153 CTATGTTCTGGGTGAATGGAGGG - Intergenic
1093666215 12:21816424-21816446 CGGTGCTCTGGGAGCATGGATGG + Intronic
1094063789 12:26342238-26342260 GTGTGAACTGGTAGGAAGGAGGG + Intronic
1096441545 12:51647849-51647871 CTCTGCACTGGGAGGAAGGTGGG - Intronic
1097015365 12:55982436-55982458 CTGTGAACAGGGAGGAAGGCAGG + Intronic
1100026929 12:90141208-90141230 CTGTGTTCTAGGACCATGGATGG - Intergenic
1100650689 12:96585503-96585525 CTGTGAAGTGGGGGAATGGAAGG - Intronic
1100681782 12:96931863-96931885 CTGGGTAGTGGGATTATGGATGG + Intronic
1100720060 12:97348411-97348433 CTTTGTTCTGGCAGGATGCAGGG + Intergenic
1101614867 12:106326351-106326373 CTGTCAACAGGGAGGGTGGATGG - Intronic
1101796674 12:107981448-107981470 CTGTGTGCTGGGCAGATTGAGGG + Intergenic
1102968570 12:117148051-117148073 CTGTGTACTTCGGGGATGCAGGG - Intronic
1103361403 12:120356584-120356606 CTGTGTACTGGATGGATGAATGG + Intronic
1103842421 12:123875916-123875938 CTGGGTTTTGGGAGGATGAAAGG + Intronic
1103907832 12:124336310-124336332 CTGTGTCCAGGGAGCAGGGATGG - Intronic
1103951569 12:124554372-124554394 CTGGGTGGTGGGAGGCTGGAGGG - Intronic
1104963891 12:132500573-132500595 CTATGGACTGGGTGGGTGGAGGG - Intronic
1105767049 13:23570568-23570590 CTGTGGACTAGGAGGTGGGAGGG + Intronic
1106322869 13:28658948-28658970 GTGTGGGCTGGGAGGAGGGAGGG - Intergenic
1107017713 13:35721099-35721121 CTGGGGACTGGGATGATGCACGG + Intergenic
1108123239 13:47212528-47212550 CTTGGTGGTGGGAGGATGGAGGG + Intergenic
1109241010 13:59888251-59888273 CTGTGTTCTGAGATGGTGGAGGG - Intronic
1109352644 13:61204821-61204843 ATGTGTAATGGGAGGATACAAGG - Intergenic
1111365298 13:87235065-87235087 CAGTGGACTGGAAGGATGGGGGG - Intergenic
1112251135 13:97781722-97781744 CTGGGTCAGGGGAGGATGGAAGG + Intergenic
1113485671 13:110650721-110650743 GTGTGAACTGGGAGATTGGAAGG - Intronic
1113636011 13:111919574-111919596 CTGTGTAATGGGAGGATGCCTGG - Intergenic
1113743475 13:112726416-112726438 CTGTGTGCAGGGAGAATGGCCGG + Intronic
1113934130 13:113984497-113984519 GTGAGTAATGGGTGGATGGACGG - Intronic
1113934463 13:113986417-113986439 GTGAGTAATGGGTGGATGGACGG - Intronic
1113934807 13:113988407-113988429 GTGAGTAATGGGTGGATGGACGG - Intronic
1113934998 13:113989283-113989305 GTGAGTAATGGGTGGATGGACGG - Intronic
1117448438 14:55827448-55827470 CAGTGTAACGGGTGGATGGAAGG - Intergenic
1119866395 14:77978638-77978660 CTGTGAAATGAGAGAATGGATGG + Intergenic
1123766558 15:23484864-23484886 CTGTGTACTGGGAGACCTGATGG + Intergenic
1130016146 15:80187925-80187947 GTGAGGACTGGGAGGATGGAAGG + Intergenic
1130332751 15:82934490-82934512 CGGGGAACTGGGAGGATGGGTGG - Intronic
1132488808 16:213302-213324 CTGAGTACTGGGAGGATCCTGGG + Intronic
1134022348 16:10929838-10929860 CTGTTTATTGGGAGGGAGGAGGG + Exonic
1135169250 16:20168737-20168759 CTGAGGACTGGGAGAAGGGAGGG - Intergenic
1136045734 16:27613592-27613614 CTGTGTTCTGGGAAGATGCATGG + Intronic
1136774626 16:32865201-32865223 CTGTGTGCTGGGAGGCTACAAGG + Intergenic
1136895986 16:33996313-33996335 CTGTGTGCTGGGAGGCTACAAGG - Intergenic
1137494286 16:48957784-48957806 CTGTGTGCTGGGAGGTGGGATGG - Intergenic
1137702261 16:50505870-50505892 CAGTGTCCTGGGAGGTTGGGGGG - Intergenic
1137902338 16:52282290-52282312 CTGTGTGATGGATGGATGGATGG - Intergenic
1138170166 16:54841671-54841693 CTGTGTGTTGGGAGGAAGGGAGG + Intergenic
1139367830 16:66444470-66444492 CAGTGCAGGGGGAGGATGGAGGG + Intronic
1139389593 16:66598301-66598323 CAGTCTGCTGGCAGGATGGATGG + Intergenic
1140473294 16:75226631-75226653 CTTTGTACTGGGAGGATAGGAGG - Intergenic
1140506196 16:75474672-75474694 CTGTGTCCTAGCATGATGGAAGG + Exonic
1140864923 16:79051562-79051584 CTGTGTGCTGGGTGGGTGGGAGG + Intronic
1140913064 16:79470769-79470791 CTGTTGAATGGGTGGATGGATGG + Intergenic
1140979559 16:80093753-80093775 CTCTGTACAGGGAGGATCCAAGG + Intergenic
1141105388 16:81229232-81229254 GTTTGCACTGGGAGGGTGGAAGG - Intergenic
1141286570 16:82678169-82678191 CTGTGTATTGGATGGATGGATGG + Intronic
1141646763 16:85371721-85371743 CAGTGAGCTGGGAGGATGGGAGG - Intergenic
1142132057 16:88435658-88435680 CTGTGTCCAGGGAGGATGGATGG + Exonic
1203077053 16_KI270728v1_random:1127337-1127359 CTGTGTGCTGGGAGGCTACAAGG + Intergenic
1143199243 17:5100678-5100700 CGGTGCCCTGGGAGGAGGGATGG - Intergenic
1143623793 17:8096530-8096552 CTGAGAACAGGGAGGATGGAAGG + Exonic
1144665477 17:17099189-17099211 GTGTGTCCAGGGAGGAGGGAGGG - Intronic
1144775835 17:17784173-17784195 CTGGGGACTGGGGGGAGGGAGGG + Intronic
1145840841 17:27993051-27993073 CTGTGATCTGGGTGGGTGGAAGG - Intergenic
1145890032 17:28407752-28407774 CTGATTCTTGGGAGGATGGATGG + Intergenic
1146282984 17:31557518-31557540 CGGTGTCCTGGGGGGATGAAAGG - Intergenic
1146928810 17:36763656-36763678 CTGTGGACTGGGTGGAAGAAGGG + Intergenic
1148107124 17:45124651-45124673 ATGTCTACTGGGTGGCTGGATGG - Intronic
1148157851 17:45433450-45433472 CAGTGTTCTGGGAGGAAGAAGGG + Intronic
1148579756 17:48735398-48735420 CTCTGTGCTGGGTGGCTGGAGGG - Intergenic
1148638277 17:49165707-49165729 CTTTGTCCTTGGAGGAAGGAAGG - Intronic
1148806897 17:50268503-50268525 CTGTGGGCCGGGAGGGTGGAGGG - Intergenic
1151494841 17:74453215-74453237 CTGTCTACTGGGTGGACGGGAGG + Intergenic
1151521279 17:74632124-74632146 GTGTGAGCCGGGAGGATGGAAGG - Intergenic
1151605992 17:75136386-75136408 CTGTGGAGTGGGAGCATGGTGGG - Intronic
1151873427 17:76851842-76851864 CTGAGATCTGGGATGATGGATGG + Intergenic
1154312771 18:13280463-13280485 CTGTGTGCTGGGGGGATTGGAGG + Intronic
1155410776 18:25542385-25542407 CTGTGTGCTGGGAAGATAAAGGG + Intergenic
1157399348 18:47374038-47374060 CTGTGTGCTGGTAGCAGGGAAGG + Intergenic
1157990247 18:52487118-52487140 CTGTGGACTGGGAGGGTTGGTGG + Intronic
1158212226 18:55064672-55064694 CTGGGTGGTGGGAGGAAGGAAGG + Intergenic
1158848189 18:61466941-61466963 TTGTTTGCTGGGAGTATGGAAGG - Intronic
1158911947 18:62073199-62073221 GTGTGTAAGGGGGGGATGGAGGG + Intronic
1160008880 18:75088876-75088898 CTATGGACTGAGAGGCTGGAGGG - Intergenic
1160040481 18:75340394-75340416 ATGTGAACTGGGAGGATGGACGG + Intergenic
1160572479 18:79827534-79827556 CTGTGTTCCTGGAGGAAGGAGGG + Intergenic
1162070858 19:8151433-8151455 CTGTGTCCGGGGAGCATTGAGGG + Intronic
1162158589 19:8696298-8696320 ATGTGTTTTGGGAAGATGGATGG + Intergenic
1162939098 19:13997385-13997407 CTGTGAAATGGGAGGACGGCTGG + Intronic
1163149432 19:15402265-15402287 CTGTGTCCTGGGAGGAGGTCTGG - Intronic
1163302636 19:16457541-16457563 CTGGGTCCTGGAGGGATGGAGGG + Intronic
1163383570 19:16985382-16985404 AAGTGTAGTGGGTGGATGGATGG + Intronic
1163751064 19:19078136-19078158 CTGTATATGGGGAGGCTGGAGGG + Intronic
1164465260 19:28482346-28482368 CTGTGTTCTAGGAGAATGGGTGG + Intergenic
1164514344 19:28921442-28921464 CTGTGGAGTGAGAGGCTGGAGGG + Intergenic
1165149653 19:33753432-33753454 GTGGGTGGTGGGAGGATGGAGGG - Intronic
1165448424 19:35869157-35869179 CTGGGTCCTGGGAGGCTGCAAGG - Intronic
1165482396 19:36072360-36072382 GTGTGTCCGGGGAGGATGGTGGG + Intronic
1165730608 19:38142501-38142523 CCCTGCCCTGGGAGGATGGACGG - Intronic
1165998531 19:39863204-39863226 TTGGGGGCTGGGAGGATGGATGG - Intergenic
1167221831 19:48204300-48204322 CTGGGAACTGGAGGGATGGAGGG + Intronic
1167769127 19:51502811-51502833 CTATGTACTGGGAGGAAGGTGGG + Intergenic
1168021627 19:53612988-53613010 GTGTTTACAGGGAAGATGGAGGG + Intergenic
1168694021 19:58395053-58395075 CTGTGGTCTGGGTGGATGGGTGG + Intergenic
926294368 2:11558112-11558134 CTGTGATTTGGGAAGATGGAAGG + Intronic
926332775 2:11838715-11838737 CCCTGTGCTGGGAGGCTGGAGGG + Intergenic
926641863 2:15245596-15245618 CTGTTGAATGGAAGGATGGATGG + Intronic
926689761 2:15725233-15725255 CTGTGTCCTGGTGGCATGGAAGG - Intronic
926789439 2:16555449-16555471 CTGAGCACTGAGTGGATGGAAGG - Intronic
927483836 2:23475261-23475283 GTGTGTATTCGGAGGATGGGCGG + Intronic
928255469 2:29718550-29718572 CTGAGTGCAGGGAGGAGGGAAGG + Intronic
930575062 2:53136480-53136502 ATGGGAAGTGGGAGGATGGAAGG + Intergenic
931062479 2:58546766-58546788 CTGCCTACTGTGAGGATGAAAGG - Intergenic
932504280 2:72213788-72213810 CTGTGTCCTCGCATGATGGAAGG - Intronic
933687884 2:85157805-85157827 CTGGGTAGGGGCAGGATGGAGGG + Intronic
934526578 2:95055849-95055871 CTGTGTGCTGGGACCATTGAGGG + Intergenic
934861564 2:97767822-97767844 CTGTGGGCTGGGAGGACAGAAGG - Intronic
934917690 2:98313476-98313498 TTGTGTCCTGGAAGGAAGGAAGG + Intergenic
935034555 2:99356687-99356709 CTGTGTAATGGTAGGAAGTAAGG - Intronic
935479894 2:103573936-103573958 CTATGTACTGGGTAGATTGAAGG - Intergenic
936462658 2:112724010-112724032 CAGTGTGCTGGGGGGATGGTGGG + Intronic
936520664 2:113210260-113210282 AGGTCTACTTGGAGGATGGAGGG - Intergenic
936659481 2:114526686-114526708 CTGTGTCCTCGCATGATGGAAGG + Intronic
936972893 2:118191845-118191867 TAGATTACTGGGAGGATGGAGGG + Intergenic
937473486 2:122193602-122193624 TTTTTTCCTGGGAGGATGGATGG - Intergenic
938097468 2:128473121-128473143 CTGGGTCCTGCGGGGATGGAAGG - Intergenic
938464846 2:131518778-131518800 CTGTGATCTGGCAGGAAGGAGGG + Intergenic
939582772 2:143970057-143970079 ATGTGAACTGTGAGGATGCAGGG + Intronic
941200010 2:162496395-162496417 ATGCGCACTGGGGGGATGGAGGG + Intronic
946046824 2:216828352-216828374 ATGTTTACTGGATGGATGGACGG - Intergenic
946074482 2:217062658-217062680 CTGGCTACTGGCAGGATTGAGGG + Intergenic
946230239 2:218286772-218286794 ATGTGTACTGGAGGGAGGGATGG + Exonic
946284419 2:218692412-218692434 CTGTGAACTGAGAGAATGAATGG + Intronic
946880207 2:224170020-224170042 CTGTGCAATGGAAGGCTGGAAGG + Intergenic
1169198650 20:3697040-3697062 CTGGGGACTTGGAGGGTGGAGGG - Intronic
1169224726 20:3848833-3848855 TTGGGCACTGGGTGGATGGAAGG - Intronic
1169278843 20:4250343-4250365 CTTTTAACAGGGAGGATGGAAGG + Intergenic
1169417669 20:5431793-5431815 TTGTGTGCTGGGAGGCTGGCTGG - Intergenic
1169497559 20:6129824-6129846 CTGGGGAATGGGAGGCTGGATGG + Intergenic
1169549480 20:6687609-6687631 CTGGGTACTTGGAGGAAAGAGGG - Intergenic
1170832056 20:19851176-19851198 CTGGGAACTGGGGTGATGGAGGG + Intergenic
1170948068 20:20909856-20909878 CTGCGTACTGGGAGGAGGGGTGG - Intergenic
1170975583 20:21160835-21160857 CTGTGTGCTCGCAGGGTGGAAGG - Intronic
1172735134 20:37121076-37121098 CTGTGTGCTGGTAAGTTGGAGGG - Intronic
1173324265 20:42018403-42018425 CTGTGGGCTGGGTTGATGGATGG + Intergenic
1174845700 20:53941124-53941146 GTGTGAAGTGGGAGGAGGGAGGG + Intronic
1174936042 20:54869882-54869904 CTGTGTGCTGGAAGGACAGAGGG + Intergenic
1175548859 20:59802606-59802628 CTGTGTGCAGGGAGCGTGGAAGG + Intronic
1175905494 20:62377621-62377643 CTGTGTCCTGGCCGGATGGTTGG + Intergenic
1177179405 21:17728447-17728469 CTGTGTTCTGAAAGGAGGGAAGG - Intergenic
1177867484 21:26529800-26529822 CTGTTTGCTGGAATGATGGAGGG + Intronic
1179051368 21:37891184-37891206 CTGTGTGCTGGATGGATGAAAGG + Intronic
1179165736 21:38933824-38933846 CTGGGCACAGGAAGGATGGAGGG - Intergenic
1179641326 21:42749333-42749355 CTGTGTACTTGGACGATGGTGGG - Intronic
1179893447 21:44349369-44349391 CTCTGATCTGGGAGGAGGGAGGG - Intergenic
1179952264 21:44715167-44715189 CTGTGTCCTTAGAGGATAGATGG - Intergenic
1179995122 21:44970702-44970724 CAGTGGCCTGGGAGGCTGGAGGG + Intronic
1180898302 22:19353293-19353315 GTGAGGCCTGGGAGGATGGAGGG + Intronic
1181111348 22:20604805-20604827 CTGTGTTCTGGCGGGAGGGAGGG - Intergenic
1181755502 22:25021600-25021622 TTGTGTATTGGAAGGAAGGAAGG + Intronic
1183395853 22:37570406-37570428 CTGTGAACTGTGGGGAGGGAGGG + Exonic
1183467869 22:37988920-37988942 CTATGCACTGGGAAGGTGGAGGG + Intronic
1183667367 22:39253545-39253567 CCGAGTTCTGGGAGGAGGGAAGG + Intergenic
1183803193 22:40185613-40185635 GTGTGTCCAGGGAGGATTGAGGG + Intronic
1184458333 22:44623944-44623966 CTGTGTGCTGGGGGGAGGGATGG + Intergenic
1184564939 22:45286142-45286164 CTGTCTGCAGGGAGGAGGGAAGG + Intronic
1184744680 22:46449408-46449430 CTGTGTGATGGGTGGTTGGATGG - Intronic
1184946391 22:47807257-47807279 CTGGGTGCTGAGTGGATGGATGG + Intergenic
949602968 3:5621250-5621272 CTGTGTCCTCACAGGATGGAAGG + Intergenic
950591162 3:13936362-13936384 CTGTGTACTGGGAGCCAGAAGGG + Intergenic
950728946 3:14939407-14939429 CTGTGCACAGGCAGGATGGAGGG + Intergenic
951546222 3:23828944-23828966 CAGTGGACAGGGTGGATGGAAGG + Intronic
951866621 3:27315877-27315899 ATGGGGACTGGAAGGATGGATGG + Intronic
952083995 3:29795704-29795726 CTGTAAACTGGGAGGAAGGAGGG + Intronic
952157841 3:30662668-30662690 CTTTTTACTAGGATGATGGATGG + Intronic
952408578 3:33026742-33026764 CTCTCTGCTGAGAGGATGGAGGG + Intronic
953412113 3:42696523-42696545 CTGCAGCCTGGGAGGATGGAGGG - Intronic
954336666 3:49922473-49922495 CTCTGTAAAGGGAGGAAGGAAGG + Intronic
956840064 3:73131118-73131140 CTGTGTCCTCAGATGATGGAAGG + Intergenic
958192758 3:90204594-90204616 CTGTGAACTGGGCGGTTGGATGG - Intergenic
960021333 3:112957084-112957106 CTGTGTACTTGGGGGAAAGAGGG - Intronic
961567823 3:127776178-127776200 CTGGGGCCTGGAAGGATGGAAGG - Intronic
961864825 3:129945997-129946019 CTGTGAAATGGGAGGGTGAATGG - Intergenic
961941810 3:130646186-130646208 CTGTGTCCTGGGATAATGTAAGG + Intronic
962297280 3:134202353-134202375 ATGTTTACTGGATGGATGGAGGG + Intronic
962471039 3:135709303-135709325 CTGTTTTTTGGGAGGAGGGATGG - Intergenic
963667868 3:148212512-148212534 CTCTGCACTGGGAAGAGGGAAGG + Intergenic
964142493 3:153419827-153419849 GTGTGTACTGGCAGGTTGGCAGG + Intergenic
965240207 3:166187400-166187422 CTGCACACTGGGAGGATGGGTGG - Intergenic
965355617 3:167669486-167669508 TTGTATTTTGGGAGGATGGAGGG + Intergenic
965486010 3:169279359-169279381 TTGTGTAGTGGGGGGAAGGAGGG - Intronic
965641319 3:170831462-170831484 CTGTGTGCTGGAAGGACGAAAGG + Intronic
965898236 3:173605167-173605189 ATGTGTACTGGTAGTATGCATGG + Intronic
966302485 3:178495103-178495125 CTGGGCACCTGGAGGATGGAGGG - Intronic
966311835 3:178602550-178602572 CTGGGTACTGGGAGGTTCGGGGG + Intronic
966809270 3:183828736-183828758 CTTTGTCCTGGGAGGATCGAAGG - Intergenic
966926458 3:184647641-184647663 CTGCCTGCTGGGAGGATTGATGG + Intronic
967981310 3:195066801-195066823 CTGTGCACTGGGGGGTTGGAAGG + Intergenic
968957866 4:3728281-3728303 CTGTGTCCCGGGAGGCTGGCTGG - Intergenic
969278052 4:6150290-6150312 CTCTGTACTGGGAGGTTGGGTGG - Intronic
969368132 4:6712186-6712208 CTGTGTCCTCACAGGATGGAAGG + Intergenic
970318949 4:14856623-14856645 GTTTGTCCTGGGAGGAGGGAGGG + Intergenic
970956362 4:21816564-21816586 CTGTGTACTGGGAGAAAGGGAGG - Intronic
973113653 4:46427619-46427641 CCATGTAATGGGAGGAAGGAAGG - Intronic
974015430 4:56644598-56644620 CATTGTTCTGAGAGGATGGAAGG - Intergenic
974247438 4:59338477-59338499 AAGTTTACTGTGAGGATGGAGGG - Intergenic
975337685 4:73199251-73199273 GTGTGTGTTGGGAGGAGGGAAGG + Intronic
975347331 4:73307139-73307161 TTGTGTTCTGTAAGGATGGAGGG + Intergenic
977730646 4:100347185-100347207 CTGTGTCCTTGTATGATGGAAGG - Intergenic
978546153 4:109874618-109874640 CTCTGTCCTGTGAAGATGGAAGG - Intergenic
979609413 4:122673489-122673511 CTGTGTACTTGGAGGATGGGTGG - Intergenic
981033778 4:140151314-140151336 CGGAGAACTGGGAGGAGGGAAGG + Intronic
981425881 4:144602511-144602533 TTGTGTACGGGGAGTCTGGAGGG + Intergenic
982361982 4:154528652-154528674 CTCTGTGCTGGAAGGAGGGAAGG + Intergenic
982402464 4:154983413-154983435 CTGTGTCCTGGGACGTTGAAAGG + Intergenic
983566898 4:169162939-169162961 CTGGGTAAGGAGAGGATGGAGGG - Intronic
983934726 4:173493449-173493471 GTGTGTACTGGGAAGATGACTGG - Intergenic
984893553 4:184515200-184515222 CTGTCTGATGGGAGGATGGGAGG - Intergenic
985553317 5:544004-544026 CCGTGGGCTTGGAGGATGGATGG - Intergenic
986302321 5:6487806-6487828 CTGTATCCTGGAAGGATGAATGG + Intronic
988737588 5:34038271-34038293 GTGAGCACAGGGAGGATGGAAGG + Intronic
990157112 5:52889676-52889698 CTGTGGCCTGGGAGGATAGTGGG - Intronic
990535354 5:56716238-56716260 CTGAGCACTGGGAGGATTGGAGG - Intergenic
991501257 5:67279563-67279585 CTGTGTACTGGAGAAATGGAGGG - Intergenic
991641719 5:68760915-68760937 GTTAGTACTGGTAGGATGGATGG - Intergenic
992657110 5:78921894-78921916 CTGTGTTCTTGGGGGAAGGAAGG + Intronic
992835204 5:80633758-80633780 CTGTGTACTGCTAGGATGATGGG - Intronic
993256981 5:85604456-85604478 CTGTGTCCTTGGGGGAGGGAGGG + Intergenic
997200564 5:132007613-132007635 CAGTGTTGTGGGAGGATGGAAGG + Intronic
997665241 5:135625298-135625320 CTGTGTGCTGTGAAGATGGAGGG + Intergenic
999230558 5:150059461-150059483 CCGTGTTCTGGGAGTGTGGAGGG - Intronic
999452111 5:151686270-151686292 TTGTGTATTGGGGGGACGGAAGG + Intronic
1000369343 5:160519840-160519862 CTTTGTTCTGTAAGGATGGAGGG - Intergenic
1002342913 5:178528375-178528397 CTGTGACCTGGGATGAGGGAAGG - Intronic
1002364223 5:178697540-178697562 CTGTTTCGTGGGAGGATGGCTGG - Intergenic
1002578992 5:180195853-180195875 CTGTGGGCAGGGAGGATGCACGG - Intronic
1002910482 6:1487472-1487494 CGGTGTTCTGGGATGATGGCAGG + Intergenic
1003115567 6:3281647-3281669 CTGTGAAGTGGGGGGATGGTAGG + Intronic
1004294717 6:14400218-14400240 CTGTATCCTGGGAGGGAGGATGG - Intergenic
1004945840 6:20611733-20611755 CTGTGTACTGGGAACATGTCAGG + Intronic
1005122323 6:22403296-22403318 CAGTGTCCTTGGAGGGTGGAAGG - Intergenic
1006272316 6:32973703-32973725 TTGTGTAGTGGGTGGGTGGAAGG + Intronic
1007170762 6:39861741-39861763 CTGAAAACTGGGAGGGTGGAGGG - Intronic
1007420396 6:41715709-41715731 CCCTGTACTGGGAGCATGGGAGG - Intronic
1007508783 6:42359334-42359356 GACTGTCCTGGGAGGATGGATGG - Intronic
1007724368 6:43905993-43906015 CTCTGTGATGTGAGGATGGAAGG + Intergenic
1007832471 6:44649017-44649039 CCCTGGACTGGGAGGGTGGAAGG - Intergenic
1008166390 6:48143911-48143933 CTACGTACTGGGAAGATGAAGGG - Intergenic
1010873027 6:81064757-81064779 ATGCATACTGGGAGGATGGGAGG - Intergenic
1011371428 6:86640986-86641008 ATGTGTGCTGGGAAGGTGGAGGG + Intergenic
1011558491 6:88592276-88592298 ATGGGGACTGGAAGGATGGAAGG + Intergenic
1011657266 6:89563292-89563314 CAGTGGGCTGGGAGGATGGAGGG + Intronic
1013283600 6:108661628-108661650 CTCTGTACAGGGATGATGTAAGG - Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013675619 6:112458451-112458473 CTGGGAACTGGGATGATGGCAGG - Intergenic
1015065832 6:129025725-129025747 CTGTGGTCTGGGTGGATGCAGGG + Intronic
1016233205 6:141831114-141831136 CTGTGCACTGGGAGGATGGGAGG - Intergenic
1017870586 6:158483331-158483353 CTTTTTATTGGGGGGATGGAGGG + Intronic
1018707758 6:166475437-166475459 CAGAGTAGTGGGAGGAAGGAAGG - Intronic
1018833253 6:167462561-167462583 CTGTGTGCTGGGAAGGTGGGAGG + Intergenic
1018880353 6:167872521-167872543 CTGTGTGGAGGGAGGATAGAGGG + Intronic
1018924079 6:168194517-168194539 CTGTGTTCTTGGAGGCTAGAGGG + Intergenic
1019299608 7:296501-296523 CTGTGCTCGGGGAGGATGGAGGG - Intergenic
1019486723 7:1292821-1292843 CTTTGTCCTGGGAGTAGGGATGG + Intergenic
1019914665 7:4125054-4125076 ATGGGTAATGGGTGGATGGATGG + Intronic
1021945431 7:25721472-25721494 CTGGGCACTGGGTGGAAGGAAGG - Intergenic
1021976674 7:26018038-26018060 ATGTGTACTGGTGGGAGGGAAGG - Intergenic
1022959232 7:35410426-35410448 CTGTGTCGCAGGAGGATGGATGG - Intergenic
1023060051 7:36318089-36318111 CTGTGTACCTGGAGGAGGGTGGG + Intergenic
1023092822 7:36632502-36632524 CTGGGGTCTGGGAGGAAGGAAGG + Intronic
1024556158 7:50605105-50605127 CTGGGTGCTGGGAACATGGAAGG + Intronic
1026668624 7:72366632-72366654 CTCAGAAGTGGGAGGATGGAAGG - Intronic
1027258210 7:76444780-76444802 CTGTGCCCTGGGGGCATGGAAGG + Intergenic
1027280638 7:76607239-76607261 CTGTGCCCTGGGGGCATGGAAGG - Intergenic
1029179021 7:98685920-98685942 CAGAGTGCTGGAAGGATGGATGG + Intergenic
1029480766 7:100811519-100811541 CTGGGGACTGGGAGGATGACCGG + Intronic
1029601093 7:101563885-101563907 CTGTGGAGAGGGAGGAGGGAAGG - Intergenic
1029707596 7:102283969-102283991 CTGTGCTCTGGGACGCTGGAGGG + Intergenic
1031479941 7:122266414-122266436 TTGTTTACTGGATGGATGGATGG + Intergenic
1032458870 7:132094515-132094537 AGGTGTACTGAGAGGAGGGAAGG - Intergenic
1033017105 7:137682556-137682578 CTGTGGATTGGGAGGAAGAAGGG - Intronic
1033024691 7:137760848-137760870 CTCTGGACTGGAAGGAAGGAGGG - Intronic
1033890407 7:146006319-146006341 GTGCGTTCTGGGAGGATGCAAGG - Intergenic
1034844271 7:154430024-154430046 CTGAGAACTGGGAGGGTGGATGG - Intronic
1036684120 8:10897857-10897879 CTGTGTATTGGGGGAAGGGAGGG + Exonic
1036694426 8:10965297-10965319 CTCTGTAGTGAGAGGATCGAGGG - Intronic
1038325141 8:26567285-26567307 ATGTGTGGTGGGTGGATGGATGG - Intronic
1040482281 8:47836965-47836987 CTGTGGATTGGGAGGAATGAGGG + Intronic
1042070175 8:64924287-64924309 CTGTGTAGTTGGGGGAAGGAGGG + Intergenic
1044368896 8:91384753-91384775 CTGACTGCTGGGAGGAAGGAAGG + Intronic
1044599956 8:93993623-93993645 CTGTGAGCTGGGAGGCTCGATGG - Intergenic
1049359994 8:142207808-142207830 ATGGGGAATGGGAGGATGGATGG + Intergenic
1051733706 9:20175850-20175872 CTGTATGATGGAAGGATGGAGGG + Intergenic
1052528127 9:29647759-29647781 CTGTGTCCTCAGATGATGGAAGG - Intergenic
1052617519 9:30860781-30860803 TTGTGTAATGGATGGATGGATGG + Intergenic
1053105549 9:35405050-35405072 CTCTGTACAGGCTGGATGGAAGG + Exonic
1055425238 9:76188598-76188620 CTGTCTCCTGTGAAGATGGACGG + Exonic
1056238994 9:84624682-84624704 CTGTGTATTTGGAGGAAGGAGGG - Intergenic
1056913539 9:90725357-90725379 CTGTCTACAGGAAGGAGGGAAGG - Intergenic
1057272431 9:93658550-93658572 GTGTGTCCTGGGAGGAAGGTGGG + Intronic
1058468749 9:105255709-105255731 TTGTGTACTGGCAGGAGGGTGGG + Intronic
1058667442 9:107333402-107333424 CTGTGTACTTTGTGGATGGGAGG + Intergenic
1059621833 9:116014152-116014174 CTTTGTACTGGGGAGATGGTTGG + Intergenic
1062464560 9:136675377-136675399 CTGGGGACTGGGAGCAGGGAGGG + Intronic
1062464601 9:136675500-136675522 CTGGGGACTGGGAGCAGGGAGGG + Intronic
1185581161 X:1212577-1212599 CTTTCTGCTGGGAGGCTGGATGG - Exonic
1185583364 X:1227375-1227397 CTGAGGAATGGGTGGATGGATGG + Intergenic
1185762811 X:2701279-2701301 CCATGGACTGGGAGGGTGGATGG - Intronic
1186468922 X:9806003-9806025 CTGTGTCCTCACAGGATGGAAGG - Intronic
1186505722 X:10090375-10090397 CTGTGTACAGGGAGAATATATGG - Intronic
1186641781 X:11463247-11463269 GTGTGGAGAGGGAGGATGGAGGG + Intronic
1186858944 X:13652543-13652565 CTGGGTGCTGGCAGGAAGGAGGG - Intergenic
1187125735 X:16452605-16452627 CTGTGTATTGGATGGATGGCAGG - Intergenic
1187221761 X:17334095-17334117 CTGTGTACTCAGATGATGGAAGG + Intergenic
1187461296 X:19489621-19489643 CTGTGTCCTGGAATGATGAAAGG - Intronic
1187547721 X:20268404-20268426 CTGGGTCCCGGGAGGATGAAAGG - Intergenic
1187636675 X:21237398-21237420 CTGTGTGCTAGGAGGAGGGAGGG + Intergenic
1188111238 X:26197933-26197955 CTGAGGACCGTGAGGATGGAAGG + Intergenic
1188668266 X:32851733-32851755 CTGTGTGCTTGCAGGAGGGAGGG + Intronic
1191075163 X:56445144-56445166 ATGTGTCTAGGGAGGATGGAAGG + Intergenic
1192305138 X:69951236-69951258 CTGTGTACTCACATGATGGAAGG - Intronic
1195048922 X:101079421-101079443 GTGTGTGCTGGAAGGAGGGAAGG - Intronic
1197046489 X:122004174-122004196 CTGGAGCCTGGGAGGATGGAAGG - Intergenic
1197487853 X:127075476-127075498 CTGTGTGCTTGGGGGAGGGAGGG - Intergenic
1198024233 X:132689120-132689142 CTGTGCACTAGGATGAAGGAGGG - Intronic
1199608753 X:149596357-149596379 CGGGGTAGTGGGAGGAAGGAGGG - Intergenic
1199630369 X:149773003-149773025 CGGGGTAGTGGGAGGAAGGAGGG + Intergenic
1200105317 X:153708854-153708876 CTGTGTGCTGGGAGGCTACAGGG - Intronic
1200281673 X:154781980-154782002 ATGTGTCCTGGGCAGATGGAGGG - Intronic