ID: 1077793111

View in Genome Browser
Species Human (GRCh38)
Location 11:5462355-5462377
Sequence CTGTGTGAACTCAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 457
Summary {0: 1, 1: 0, 2: 6, 3: 41, 4: 409}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077793106_1077793111 9 Left 1077793106 11:5462323-5462345 CCATGTTGCTCAGAGTTTTATGG 0: 1
1: 0
2: 2
3: 12
4: 209
Right 1077793111 11:5462355-5462377 CTGTGTGAACTCAGGGAAGAGGG 0: 1
1: 0
2: 6
3: 41
4: 409

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077793111 Original CRISPR CTGTGTGAACTCAGGGAAGA GGG Intronic
900159428 1:1216474-1216496 CAGTGGGAGCTCAGGGAAGCCGG - Intergenic
901652142 1:10749131-10749153 CTATGAGCACTCAGGGAAGACGG - Intronic
902395245 1:16128910-16128932 CTGTGTGACCTCAGGCAAGCCGG + Intronic
902413354 1:16225177-16225199 CTCTGAGAACTCTGGGAAGTGGG + Intergenic
902707558 1:18216185-18216207 CTAGGTGAACTCAGAGGAGAAGG + Intronic
903651453 1:24924982-24925004 CTGTCTGAATTCCAGGAAGATGG - Intronic
904977922 1:34472703-34472725 CTGTGTGAATCAAGGGAGGATGG + Intergenic
905042666 1:34973182-34973204 CTGCGTTGACTCAGGGAAGGAGG - Intergenic
905256062 1:36685849-36685871 CTGATTGACATCAGGGAAGATGG + Intergenic
906320184 1:44810796-44810818 CTGTGTGTGCTGTGGGAAGAGGG + Intronic
906468698 1:46108715-46108737 CTGTGCTAGCTCAGGGAAGGAGG - Intronic
906676023 1:47694276-47694298 CTCTGCTACCTCAGGGAAGAGGG - Intergenic
907217825 1:52880867-52880889 CTGTGAGATCTCAGAGAAGAGGG + Intronic
907379603 1:54075283-54075305 CTGTGGGAATACAGGGGAGACGG + Intronic
908103015 1:60810674-60810696 CTGTTTGAATTCATGAAAGAAGG - Intergenic
908382658 1:63611449-63611471 CTGTGTGACCTCAGGGGTTAAGG - Intronic
908569926 1:65398744-65398766 CTGTGTGAACTCAGAAAAGTGGG + Intronic
909153768 1:72043176-72043198 AGGTGTGAACTCAGGAAAGCTGG - Intronic
909542717 1:76808416-76808438 CTGTGTCATCTCATGGAGGAGGG - Intergenic
910002119 1:82353804-82353826 CTGTGTCCACTCATGGCAGAAGG + Intergenic
911689616 1:100818196-100818218 CTTTGGGAACTCAGGGGGGAAGG + Intergenic
916171765 1:162006540-162006562 CTGTGTGCTCTGAGCGAAGATGG - Intronic
916443346 1:164848830-164848852 CTGTGTGTGCTCAGGGGAGCAGG + Exonic
919076092 1:192814636-192814658 GTGTGTGAACTCTGGGAAACTGG - Intergenic
919243645 1:194948791-194948813 CTTTGGGAACTCAGGGGAAAGGG + Intergenic
919592639 1:199523616-199523638 CTCTGGGAACTCAGGGGAAAGGG - Intergenic
920667817 1:207978597-207978619 CTGTGTCCACTCACGGCAGAAGG + Intergenic
920866295 1:209756680-209756702 CAGTGTGAACTGAGGGGAGAGGG - Intronic
922367594 1:224880633-224880655 CTGTTTGCACACTGGGAAGATGG + Intergenic
923726833 1:236513250-236513272 CTGTGTAAACACAGGGTAAATGG - Intergenic
924027075 1:239844932-239844954 CAGTGTGAACTAAGGAAAGAGGG + Intronic
1063115942 10:3071925-3071947 CTCTGTGAACTCAGGGAAGGTGG - Intronic
1063369593 10:5512476-5512498 CCGAGAGAACTCAGTGAAGAAGG - Intergenic
1063625680 10:7687660-7687682 CTGTGTGGACTCAGGAACAAGGG - Intergenic
1065272644 10:24051080-24051102 CTTTGGGAACTCAGGGAGAAGGG - Intronic
1066277412 10:33882325-33882347 CTGTGTCATCTCATGGCAGAAGG + Intergenic
1067529140 10:47057842-47057864 TTGTGTCAAGTGAGGGAAGAGGG - Intergenic
1067761993 10:49055384-49055406 CTGTGTGAAATCTTGGAAGGAGG - Intronic
1068067876 10:52154802-52154824 CTTTGGGGACTCAGGGGAGAAGG - Intronic
1068571317 10:58632525-58632547 TTCTGAGGACTCAGGGAAGATGG + Intronic
1068753605 10:60624957-60624979 GTGTGTGTGCACAGGGAAGAAGG - Intronic
1069671782 10:70211926-70211948 CTGTGTTAATTCATTGAAGAAGG - Intronic
1070578844 10:77703404-77703426 CTGTGTGACCACATGGCAGAAGG - Intergenic
1071715571 10:88091976-88091998 CTGTGCAGACACAGGGAAGAAGG - Intergenic
1071992393 10:91112649-91112671 CTGTGTGATCCCACGGCAGAAGG + Intergenic
1072252420 10:93591959-93591981 TTATGGGAACTGAGGGAAGATGG + Exonic
1072435222 10:95408405-95408427 GTGTGAAAACTCAGGAAAGAAGG + Intronic
1072618690 10:97066148-97066170 CTGTGATAAGTCAGGGAAGCAGG + Intronic
1073603029 10:104865225-104865247 CTGTGTGAAAGAAGGAAAGAAGG + Intronic
1074164782 10:110865534-110865556 CTATGTGCACTCAGGGCAGCTGG + Intergenic
1074283898 10:112079906-112079928 CTGTGAGAGGTCAGAGAAGAAGG - Intergenic
1075226813 10:120637039-120637061 CTGTGGCAAATCAAGGAAGAGGG + Intergenic
1076207632 10:128615811-128615833 CTGTTTGAGGTCATGGAAGAGGG + Intergenic
1076479759 10:130777468-130777490 TAGGGTGCACTCAGGGAAGATGG - Intergenic
1077252575 11:1567125-1567147 CTGTGGGGGCACAGGGAAGATGG - Intronic
1077524298 11:3055079-3055101 CTGAGTCAACTTAGGGAAGATGG + Intronic
1077793111 11:5462355-5462377 CTGTGTGAACTCAGGGAAGAGGG + Intronic
1078025891 11:7695389-7695411 CAGGGTGAACTCAGGGTTGAGGG + Intronic
1078988657 11:16622426-16622448 CTCTGGGAACTCAGGTAAAAGGG - Intronic
1080116240 11:28624393-28624415 CTGTGTCGTCTCATGGAAGAAGG + Intergenic
1080501252 11:32873491-32873513 CTGTGTGATCTCATGGCAGAAGG - Intergenic
1080587075 11:33692022-33692044 TTGCATGAACTCAGGGAAGAAGG - Intergenic
1081039237 11:38190379-38190401 CTGTGTGAACTTAGGACTGAGGG + Intergenic
1081273978 11:41123655-41123677 TTGAGTGAACTCAGAGAAGCTGG - Intronic
1081869957 11:46378924-46378946 GCGTGTGAGCTCAGGGAAGGAGG + Intronic
1082777162 11:57254867-57254889 GTCTGGGAACTTAGGGAAGAAGG - Intergenic
1083250660 11:61464466-61464488 CTTTGGGAGCTCAGGGAGGAAGG - Intronic
1084444882 11:69197749-69197771 CTGGGTGGCCTCAGGGAAGATGG + Intergenic
1085768219 11:79302680-79302702 CAAGGTGAACTCAGGGAACAGGG - Intronic
1085799149 11:79571992-79572014 CTGTGTGATCTCAAGCAAGTTGG - Intergenic
1086203132 11:84227328-84227350 CTGTGTGATCAGAGGGAATAAGG + Intronic
1087171815 11:95057447-95057469 CTGTGGAAACCCAGGCAAGAGGG + Intergenic
1087601855 11:100327373-100327395 CTGTGTGCAGTCTGGAAAGAGGG - Intronic
1087775499 11:102253126-102253148 CTGTGTGATCTCATGGTGGAAGG + Intergenic
1087844009 11:102950762-102950784 CTGTCTGCACTCATGGGAGACGG - Intronic
1087942437 11:104115054-104115076 CTTTGGGGTCTCAGGGAAGAGGG - Intronic
1088100082 11:106144975-106144997 CTGTGTGAGCTCTGTGAAGGTGG - Intergenic
1089569245 11:119392148-119392170 CTTTGGGGACTCAGGGAAAAGGG - Intergenic
1089784196 11:120896285-120896307 CTCTGTGACCTCAGGCAAGTTGG + Intronic
1089806815 11:121097889-121097911 CTGTGTGAAGCCAGGGATGTTGG - Intergenic
1090753207 11:129765420-129765442 CTTTGGGGACTCAGGGAAAAAGG + Intergenic
1091312240 11:134582870-134582892 CTGTGTCTGCTCAGGGAAGAAGG - Intergenic
1091663719 12:2403397-2403419 CTGTGAGGACCCAGGGAGGAGGG + Intronic
1091927438 12:4366504-4366526 GTTAGTGAAATCAGGGAAGAAGG + Intergenic
1092295708 12:7198563-7198585 TTGTGTGAACTCTGGGTAGAGGG + Intronic
1093722769 12:22463508-22463530 CTGTGTTATCACAGGGCAGAAGG - Intronic
1093845687 12:23968558-23968580 CTGTGTCATCTCAGGGTAGATGG - Intergenic
1096169231 12:49453566-49453588 CTTTGTGAAGTCAGGGCAGGAGG + Intronic
1096201670 12:49688024-49688046 CTGAGTGGATTCAGTGAAGAGGG - Intronic
1096521717 12:52188264-52188286 CTGTATGATCTAAGGGCAGAGGG - Intronic
1098493186 12:71105995-71106017 CTGTGTCATCTCATGGCAGAGGG + Intronic
1098524584 12:71471984-71472006 CTTTGGGGACTCAGGGAAAAGGG + Intronic
1100112105 12:91258091-91258113 TTGAGTGAACTTTGGGAAGAAGG + Intergenic
1100613958 12:96216303-96216325 CTGTGTGACCTCAGCAAAGAGGG - Intronic
1100706778 12:97209389-97209411 CTTTGGGGACTCAGGGAAAAAGG + Intergenic
1100857204 12:98768050-98768072 CAGTGAGAACTTGGGGAAGAGGG - Intronic
1102748983 12:115275670-115275692 CTTTGGGAACTCAGGGAGAAGGG + Intergenic
1102797262 12:115699526-115699548 CTGCATGAACTCAGATAAGATGG + Intergenic
1103734922 12:123054634-123054656 CAGTTTGAACTCAGGCAAAAAGG - Intronic
1104160684 12:126177325-126177347 CTTTGGGGACTCAGGGAAAAGGG + Intergenic
1104244057 12:127020160-127020182 CTTTGCGAACTCAGGGAGAAAGG - Intergenic
1104659054 12:130596059-130596081 CTGTGTAACATCAGGGACGATGG - Intronic
1105111984 13:16632698-16632720 ATGTGTGAACTCAGCTAACAGGG + Intergenic
1107015365 13:35704663-35704685 CTGTGCCAGCTCAGGGAGGAGGG - Intergenic
1107682472 13:42866034-42866056 CTGTGGGCACCCTGGGAAGAGGG - Intergenic
1107857396 13:44629596-44629618 CTGTGTCATCTCATGGAGGAAGG - Intergenic
1108359434 13:49655808-49655830 CTGTGTCATCTCATGGCAGAAGG + Intergenic
1109945825 13:69430246-69430268 CTTTGGGGACTCAGGGAAAAGGG + Intergenic
1110182263 13:72631770-72631792 CTTTGGGGACTCAGGGAAAAGGG + Intergenic
1110913788 13:80996922-80996944 CTTCGTGGACTTAGGGAAGATGG + Intergenic
1111115373 13:83769643-83769665 CTTTGGGGACTCAGGGAAAAGGG + Intergenic
1111251044 13:85601756-85601778 CTGTGTGTACACTGTGAAGAGGG - Intergenic
1111601863 13:90484113-90484135 TTTTGTGAACTATGGGAAGATGG + Intergenic
1111893169 13:94108364-94108386 CTTTGGGGACTCAGGGAAAAAGG + Intronic
1112742533 13:102491502-102491524 CTGTGGGCACTCAGGGAGAAAGG + Intergenic
1113072805 13:106438209-106438231 CTGTGTGAAGCCATTGAAGATGG - Intergenic
1114790675 14:25654973-25654995 CTGTGTCATCTCATGGCAGAAGG + Intergenic
1115139564 14:30154617-30154639 CTGTGAGAAGTTAGGGAAGATGG - Intronic
1115441689 14:33443088-33443110 CAGTGTTAACTGAGGGAAGCTGG - Intronic
1115909421 14:38239173-38239195 CTGAGTCAACACATGGAAGATGG + Intergenic
1116021750 14:39469643-39469665 ATCTGTGCACTCAAGGAAGAAGG - Intergenic
1117442369 14:55772014-55772036 CTCTTTGTACTCAGGGCAGAGGG + Intergenic
1117468021 14:56013792-56013814 CTGTGTCATCTCATGGTAGAAGG - Intergenic
1118907446 14:70032968-70032990 GTGTGTGCACACAGGGAAAAAGG - Intergenic
1119424572 14:74527384-74527406 CAGCGTGAGCTCAGGGAGGAGGG + Intronic
1119513275 14:75228350-75228372 CTGTGGGAACAAAGGGAAAAAGG - Intergenic
1120287659 14:82524838-82524860 CTTTGTGAACTCAGGGGAAAGGG + Intergenic
1121510697 14:94510923-94510945 CTTTGGGGACTCAGGGAAGAAGG + Intronic
1121711987 14:96045358-96045380 CTGTGTGCACAAAGGCAAGAAGG + Intronic
1121835938 14:97092388-97092410 CTGGTTCATCTCAGGGAAGATGG - Intergenic
1125885196 15:43224170-43224192 CCGCGTGGACACAGGGAAGAGGG - Intergenic
1127226464 15:56935633-56935655 CTTTGGGGACTCAGGGAAAAGGG - Intronic
1128255645 15:66194649-66194671 CTTTGGGGACTCAGGGAAGAAGG + Intronic
1128672271 15:69582768-69582790 CTGTGTCATCTCATGGTAGAAGG + Intergenic
1129239443 15:74242816-74242838 CAGTGGGGACTCAGAGAAGACGG - Intronic
1129653719 15:77508975-77508997 CTTTGTTAACTCAGCAAAGATGG + Intergenic
1129831434 15:78673638-78673660 CGGTGTGACTTCTGGGAAGAAGG - Intronic
1130253459 15:82315218-82315240 CTGGGTGGACTCAGGGTAGGTGG - Intergenic
1130406598 15:83608588-83608610 TTGTTTGAACTCAGAGGAGATGG + Intronic
1130919933 15:88335445-88335467 CTGTGGGAACTCAGGGAGCAGGG + Intergenic
1132141328 15:99399133-99399155 CTGTGTGAACACCGAGAAAATGG + Intergenic
1132440149 15:101854479-101854501 CTGTGTGATCTCAGAAAAGCAGG - Intergenic
1133280192 16:4660767-4660789 CTGTGTGGACTCAGTGGAGTGGG + Intronic
1133577309 16:7105485-7105507 CTTTGTGGACTCAGGGGAAAGGG - Intronic
1133725466 16:8533389-8533411 CTCTGTGAGTTCATGGAAGATGG + Intergenic
1133836076 16:9368435-9368457 CTTTGGGAACTCAGGGGAAAGGG - Intergenic
1133846365 16:9457634-9457656 CTGAGAGAAGTCAGTGAAGATGG + Intergenic
1134444474 16:14320458-14320480 CTGTGGGCGCTTAGGGAAGAAGG - Intergenic
1135421634 16:22309065-22309087 CTGTGTGAACGCAGGGAAACCGG - Intronic
1135424353 16:22324923-22324945 CTCTGAGGGCTCAGGGAAGAGGG + Intronic
1135664575 16:24325150-24325172 CTGTGTCTACTGGGGGAAGAGGG + Intronic
1137513776 16:49124823-49124845 CTAGGTGAATTGAGGGAAGAGGG - Intergenic
1138482924 16:57316050-57316072 CTGTGTGATGTAAGGGAAGAAGG - Intergenic
1138631996 16:58303890-58303912 CTTTGGGGACTCAGGGAAAAGGG - Intronic
1138865219 16:60810041-60810063 ATGTGTGAACTGTGGCAAGAGGG + Intergenic
1139592240 16:67939776-67939798 CTGTGTGCAGTGAGGCAAGATGG - Exonic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1140116950 16:72050394-72050416 CTGTGGGTCCTCAGGGAAGTGGG - Intronic
1140829411 16:78737592-78737614 CTTTGGGAACTCAGGGAGAAGGG - Intronic
1142389663 16:89790807-89790829 ATGAGTGAAATCAGGAAAGAGGG - Intronic
1142629559 17:1215905-1215927 CTGTGTCCACTCAGGGTAAATGG + Intronic
1143029781 17:3961496-3961518 CTGTGTGCAGTGAGGGAGGAGGG + Intronic
1144044999 17:11447484-11447506 CTGTGTTAACTCAAGGAAGGTGG - Intronic
1144087007 17:11819049-11819071 ATGTTTGAAATCAGAGAAGAGGG - Intronic
1144390672 17:14790739-14790761 CTGTTAGAGCTCAGGGAGGAAGG + Intergenic
1146720149 17:35118474-35118496 GTGTGTGTACTTGGGGAAGAAGG - Intronic
1147407141 17:40220117-40220139 TGGTGTGAAGTGAGGGAAGATGG + Intronic
1147690974 17:42314294-42314316 CTGGTTGAGCTCAGGGAATATGG - Exonic
1147948114 17:44091935-44091957 CAGTGGGAGCTCAGGGTAGAGGG - Intronic
1148156162 17:45426240-45426262 CTGTTTGTACTCAGGGCAAATGG + Intronic
1149066810 17:52490254-52490276 TAGTGGCAACTCAGGGAAGAGGG + Intergenic
1149557272 17:57582717-57582739 CTGATTGACATCAGGGAAGATGG - Intronic
1149557675 17:57585743-57585765 CTTTCTGAGCTCAGGGGAGATGG - Intronic
1150387831 17:64774858-64774880 CTGTTTGTACTCAGGGCAAATGG + Intergenic
1151053953 17:71010900-71010922 CTGTGTGACCTCATGTAAGTGGG + Intergenic
1151905291 17:77044147-77044169 CTGTGTGCACTGTGGGCAGAGGG + Intergenic
1152894101 17:82900662-82900684 CTGCGTGTACTCAGGAAAGCCGG - Exonic
1153201312 18:2650323-2650345 TTGTTTGAACTCAGGGGACAGGG + Intergenic
1153532529 18:6062992-6063014 CTCTGGGGACTCAGGGAGGAAGG - Intronic
1154348668 18:13565291-13565313 CTGTCTGGGATCAGGGAAGATGG - Intronic
1155433185 18:25783357-25783379 ATGTGGGGACTCAGGGAAAAGGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156806716 18:41191787-41191809 CAGTGTGAACACAGGCAAGATGG - Intergenic
1157506945 18:48233256-48233278 CTGTGTCATCTCATGGAGGAAGG - Intronic
1157942601 18:51945512-51945534 CTCTGGGAACTCAGTGAAAATGG + Intergenic
1158047878 18:53178093-53178115 CTGATTGAACTGAGTGAAGAAGG - Intronic
1158794090 18:60820579-60820601 CTTTGTGGACTCAGAGAAAACGG - Intergenic
1159116988 18:64125910-64125932 CTGTGTGATCTCACAGTAGAGGG - Intergenic
1159122512 18:64187248-64187270 CTGTGGAAACTCAGGGAGAATGG + Intergenic
1159890689 18:73950569-73950591 CTGGGTCAACTCAGGTCAGAGGG - Intergenic
1160247404 18:77169760-77169782 GTGTGTGAATTCATGGAAAATGG + Intergenic
1161040713 19:2109528-2109550 CTGTGAGGACTCAGGGGGGAGGG + Intronic
1161610188 19:5238047-5238069 CTGGGTGAAGGGAGGGAAGAGGG + Intronic
1161732859 19:5972715-5972737 CTGTCTGAACTCACGTAGGAGGG + Intronic
1163196021 19:15720853-15720875 CTGTGTCAACTCAGGTCTGATGG + Intergenic
1163311394 19:16517044-16517066 CTGTGGGAACACAGGGTAGAGGG - Intronic
1164717575 19:30404799-30404821 CTGTGGGATCTCTGGGTAGATGG - Intronic
1164717982 19:30407469-30407491 CTGTGGGATCTCCGGGTAGATGG - Intronic
1164744478 19:30601073-30601095 CTGTGGGAACACAGGGAATATGG - Intronic
1165157732 19:33798039-33798061 CGGTGTGAACTTAGGGGCGACGG - Intronic
1166152419 19:40883719-40883741 CTGTGTGACCTCACTCAAGAGGG - Intronic
1166283172 19:41808716-41808738 AGGTGTGCAGTCAGGGAAGAAGG - Intronic
1166875357 19:45893633-45893655 CTGGGGGAAGACAGGGAAGATGG + Intronic
1166994109 19:46711099-46711121 CTGTGAGAAATCAGGGAACGTGG - Intronic
1168283991 19:55321411-55321433 CTGGGTGAGCTTAGGGAAGAAGG + Intronic
1168284287 19:55322688-55322710 CTGGGTGAGCTCAGGGAAGAAGG + Exonic
925464794 2:4097440-4097462 CTGTTTGACCTCAGGCAAGCTGG + Intergenic
926226679 2:10971784-10971806 ATGGGGGAGCTCAGGGAAGAGGG + Intergenic
927495847 2:23551182-23551204 CAGCGTAAACTGAGGGAAGAAGG - Intronic
928084345 2:28336511-28336533 CTGTGTGACCCCAAGGATGATGG + Intronic
928200138 2:29242649-29242671 CTGTGTGACCTGAGGCAACATGG + Intronic
928578457 2:32680564-32680586 CTGTGTGAAATGAGGGATGGGGG + Intronic
930417136 2:51103278-51103300 TTGAGTGTCCTCAGGGAAGAGGG - Intergenic
934771599 2:96911175-96911197 CTCTGTGGACTCAGGGAGTACGG + Intronic
934900268 2:98154420-98154442 ATGTGTGCGCTAAGGGAAGAGGG - Intronic
935689837 2:105721033-105721055 CTGTGTGCTCACAGGGCAGAAGG + Intergenic
935807749 2:106765778-106765800 CTGTGTCATCTCATGGTAGAAGG + Intergenic
936548146 2:113410820-113410842 CTGTGTCCACTCATGGTAGAAGG - Intergenic
937066515 2:119022124-119022146 CTGTGTGACTTCAGGCAAGCTGG - Intergenic
938598452 2:132812590-132812612 CTGTGGGAACTCTCGGCAGAGGG + Intronic
938698466 2:133855527-133855549 CTGTCTGAACTCTGGGAAGCTGG - Intergenic
939253139 2:139709141-139709163 CTGTATCATCCCAGGGAAGAGGG + Intergenic
939918350 2:148076838-148076860 CTATGAGAACTTAGAGAAGAGGG - Intronic
941311924 2:163943851-163943873 ATATGTGAACTCAAGGGAGATGG - Intergenic
942662581 2:178281994-178282016 CTGTGTGTACTCCGGGAAGCAGG - Intronic
945762469 2:213931018-213931040 CTGAGCGAACACAGGGAATAAGG - Intronic
946081899 2:217127781-217127803 CTGTGTTTGCTCAGGGAAAATGG + Intergenic
947788338 2:232845105-232845127 CTGTGTGACCTTGGGCAAGAGGG + Intronic
1169860682 20:10148309-10148331 CTGTGAGAACTCACAAAAGAAGG - Intergenic
1169969718 20:11256380-11256402 CTGTGGGGACTCAGGGGAAAGGG - Intergenic
1170772580 20:19346675-19346697 CTTTGGGAACTCAGGGGAAAGGG + Intronic
1170938122 20:20827198-20827220 CAGTGGGAACTCAGGGAAGAGGG + Intergenic
1171215062 20:23346343-23346365 CTGTGTGAGCTCAGGCTAAATGG - Intergenic
1171773556 20:29345840-29345862 CCTTCTGAACTCAGGGAACAAGG + Intergenic
1172828393 20:37810256-37810278 CTGTGTCAACTCACGGTGGAAGG + Intronic
1173934642 20:46850704-46850726 CCGTGTGATGTCAGGGAAGCGGG + Intergenic
1174385865 20:50188465-50188487 CTGTGTGACCTTAGGCAAAATGG - Intergenic
1174412970 20:50347868-50347890 CTGTCACAACTCAGGGAAGGAGG - Intergenic
1174848348 20:53966462-53966484 CTTTGGGGACTCAGGGGAGAAGG + Intronic
1175321450 20:58091029-58091051 CTGTGTGCACGCACGGTAGAAGG + Intergenic
1175335336 20:58192500-58192522 GTGTGAGCACTCAGTGAAGATGG + Intergenic
1175785051 20:61707057-61707079 CTGTTTTATCCCAGGGAAGATGG - Intronic
1176126958 20:63479890-63479912 CTGTGTGAGACCAGGGAAGAGGG - Intergenic
1176127038 20:63480205-63480227 CTGTGAGAAACCAGGGAAGAGGG - Intergenic
1177040722 21:16106934-16106956 CTGTGTCATCTCATGGCAGAAGG + Intergenic
1177991997 21:28047953-28047975 CATTGTGAGCTCAAGGAAGAAGG - Intergenic
1178053264 21:28770702-28770724 CTGTGTGATCTCATGGTGGAAGG - Intergenic
1178791450 21:35704173-35704195 CTGTGTGAACACAAGAAGGAAGG - Intronic
1181495356 22:23284490-23284512 CTGGGTGAACCCAGGGAGGAGGG - Intronic
1181768445 22:25109037-25109059 CAGTATGACCTCAGAGAAGAAGG + Intronic
1182795190 22:32986671-32986693 CTGTTTGACCTCAGGCAAAATGG + Intronic
1183030920 22:35103944-35103966 CTGTGTGACCCCTGGGAATAGGG + Intergenic
1183104469 22:35606412-35606434 CTGTGGGAACCCAGAGGAGAGGG - Intergenic
1183526705 22:38327425-38327447 GTGTGTGATCTCAGGGGTGAAGG + Intronic
1184505035 22:44895373-44895395 CTGTGTGACCTTACGGATGAGGG - Intronic
1184849513 22:47112286-47112308 CTGGGTGAACACTGGGCAGAAGG - Intronic
949847849 3:8390100-8390122 CTCTGTTAACTGAGGGAACAGGG + Intergenic
949858731 3:8486118-8486140 CTTGGTGAACTCAGGGCAAAGGG + Intergenic
950166862 3:10807554-10807576 CTGTGAGGACACAGGGAAAAAGG - Intergenic
952083357 3:29787670-29787692 CTTTGGGGACTCAGGGAAAAAGG + Intronic
952210597 3:31225796-31225818 CTGTGTGGCAGCAGGGAAGAGGG - Intergenic
954229929 3:49209017-49209039 CTGGTTGAATTCTGGGAAGATGG + Intronic
955252361 3:57297101-57297123 GTGTTTGACGTCAGGGAAGAGGG - Intronic
955897332 3:63714398-63714420 CTGTGTGATTTCAGGCAAGCAGG + Intergenic
955963246 3:64362560-64362582 TTGTGTTAACTCAGGACAGATGG - Intronic
956262209 3:67356460-67356482 CTGTGTGATCTTAGGAAAGCTGG + Intergenic
956667938 3:71659553-71659575 CTGTGTGAACTCTGAGGATAGGG + Intergenic
961194557 3:124990688-124990710 AGGTGTGAACTGAGGGAAGTGGG + Intronic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961428865 3:126865703-126865725 CAGAGTAGACTCAGGGAAGAGGG - Intronic
961691037 3:128669692-128669714 CTGTATGATCACAGGGTAGATGG + Intronic
961939407 3:130622118-130622140 CTGAGGGATCTCAGGGAACAAGG + Intronic
962221612 3:133569091-133569113 ATGTGTGAACTGAAGGATGAGGG - Intergenic
962897346 3:139728312-139728334 CTGTGAGAAAGCAGGGAAAATGG + Intergenic
963990326 3:151645961-151645983 CTCTGTGAACAGAGGGAATAGGG - Intergenic
964909162 3:161756941-161756963 CTGTTTGAAATCAGGTAAAATGG - Intergenic
966159605 3:176953972-176953994 CTGTGTGTTCTCAGAGAAGAAGG - Intergenic
966220943 3:177550472-177550494 CTTTGGGGACTCAGGGAAAAGGG + Intergenic
966227495 3:177613728-177613750 CTGTGTGAATGCAGGTAACAGGG - Intergenic
967836549 3:193969093-193969115 CTGAGTGAACTTAGGAAGGAGGG + Intergenic
970067550 4:12116216-12116238 CACTGTGATCTCAGGGAAGCAGG + Intergenic
972644790 4:40957024-40957046 TTGTGTGACCTCAGAGAAAATGG + Intronic
974074002 4:57152047-57152069 CTGTAGGAACTCAGGGGAAAGGG - Intergenic
974293406 4:59963375-59963397 CTATCTCAACTCAGGGAAAATGG + Intergenic
974583212 4:63834331-63834353 CTTTGGGAACTCAGGGGAAAAGG - Intergenic
975416875 4:74114644-74114666 CTGTGGGACCTCAGGTAAGCTGG + Intronic
975426086 4:74229470-74229492 CTAGGAGAACTCAGGGTAGAAGG + Intronic
975733224 4:77357551-77357573 CTGTGAGACCTCAGAGAATAGGG - Intronic
976391719 4:84512398-84512420 CTGTGTGTACTGAAGGAAGCAGG + Intergenic
976416083 4:84777048-84777070 CTGTTTATACACAGGGAAGAAGG + Intronic
976517609 4:85986931-85986953 CAGTGGGAGCTCAGGGAGGAAGG + Intronic
979560030 4:122091056-122091078 CTTTGGGAACTCAGGGTGGAAGG - Intergenic
979904465 4:126269232-126269254 CTGAGTGAAGTCAGAGAACACGG + Intergenic
980569731 4:134598675-134598697 CTTTGGGGACTCAGGGAAAAGGG + Intergenic
980586383 4:134821948-134821970 CTTTGGGGACTCAGGGAAAAGGG - Intergenic
981364792 4:143889876-143889898 CTGTGTGAACTTAAGCAAGTCGG - Intronic
981746234 4:148055058-148055080 CAGTGTGGAATCAGGTAAGAGGG - Intronic
982103279 4:151989523-151989545 CTGTGTAACCACAGGGAAGCAGG - Intergenic
982287213 4:153747962-153747984 CTGTGTCATCTCATGGCAGAAGG + Intronic
984926041 4:184807906-184807928 ATGTGTGTTCTCAGGGGAGAGGG - Intronic
985170825 4:187148101-187148123 CTGCTTGCACTCAGGAAAGATGG - Intergenic
985936552 5:3101952-3101974 CTGTGTGTTCTCTGTGAAGATGG - Intergenic
985971981 5:3385419-3385441 CTTTGTGACCCCAGAGAAGAGGG - Intergenic
986007794 5:3682841-3682863 CTCTGGGGACTCAGGGGAGAGGG - Intergenic
986151795 5:5136866-5136888 CTGTTTGAACTTACAGAAGAGGG + Intergenic
986238761 5:5937927-5937949 CTATTTGAAAGCAGGGAAGAGGG - Intergenic
986313729 5:6572597-6572619 CTGTGTGAGCCCCGGGATGAAGG + Intergenic
986504542 5:8435410-8435432 CTTTGAGGACTCAGGGAGGAAGG + Intergenic
988385653 5:30561231-30561253 CCTTGTGAACTCAGGGGAAAGGG + Intergenic
988876378 5:35451462-35451484 CTTTGGGAACTCAGAGAAAAGGG + Intergenic
989135381 5:38149305-38149327 CTGTGTGATCTTAGGCAACAAGG - Intergenic
990112844 5:52349273-52349295 CTTTGGGGACTCAGGGAAAAGGG - Intergenic
990413204 5:55561564-55561586 CAGTGTGCACTCAGGCAAGAAGG - Intergenic
991447744 5:66717971-66717993 CAGTGAGAACTCAGGGATGGAGG - Intronic
991726711 5:69542743-69542765 CTGTGTGTAATCAGAAAAGAAGG - Intronic
991868246 5:71085131-71085153 CTGTGTGTAATCAGAAAAGAAGG + Intergenic
992442389 5:76808344-76808366 CTGTGAAATCTCTGGGAAGAAGG - Intergenic
993898975 5:93571620-93571642 TTATGTGAGCTCAGGGAGGAAGG + Intergenic
993907222 5:93636490-93636512 CTGTGTCTTCACAGGGAAGAAGG - Intronic
994277029 5:97851434-97851456 CTGTGTGATATTAGGGCAGAAGG - Intergenic
995189790 5:109308246-109308268 TTCTTTGAAATCAGGGAAGAGGG + Intergenic
996021534 5:118595948-118595970 CTGTGTGAAGACAGGGAACATGG - Intergenic
996402403 5:123076586-123076608 CTGTTTCCACTCAGGGCAGAAGG + Intergenic
996484555 5:124016766-124016788 CTGTGTGAACTAAGGAACAAAGG + Intergenic
998641059 5:144011799-144011821 CTGGGTGGACTCAGAGCAGATGG + Intergenic
999516333 5:152305534-152305556 CTGTGTCATCTCATGGAAAAAGG + Intergenic
999692347 5:154159049-154159071 CTTTCTGAACTCAAGGGAGAAGG - Intronic
999960957 5:156755214-156755236 ACGTGTTAACTGAGGGAAGAAGG + Intronic
1000043946 5:157506004-157506026 CTTTGAGAACTCAGGAAACATGG - Intronic
1000173831 5:158730249-158730271 CTGTGAGGACTCAGAGGAGAGGG - Intronic
1000243949 5:159433563-159433585 GAGTGTGACCTTAGGGAAGAAGG + Intergenic
1000872538 5:166594910-166594932 TTGTGTGACCTTTGGGAAGAAGG + Intergenic
1001733223 5:173975498-173975520 CTTTGGGAACTCAGGGGAAAGGG - Intronic
1001818912 5:174694387-174694409 CTGTCAGAACGCAGGGAAGTCGG - Intergenic
1001867194 5:175116077-175116099 CTGTGTGAAGTGAAGGAAGCTGG - Intergenic
1002111651 5:176918736-176918758 CTATGTAAACTAAGGCAAGAAGG - Intronic
1002359377 5:178658588-178658610 CTGTGTGCACACAGGGAAGATGG + Intergenic
1002428832 5:179191529-179191551 CAGTGTGACCTAAGGAAAGAGGG + Intronic
1002783643 6:385047-385069 CTGTGTGTACTGATGGAAAATGG + Intergenic
1002900002 6:1402393-1402415 CTGTGGGAACTCAGGTCACAGGG + Intergenic
1002915296 6:1524003-1524025 CTGTGTGAATGCAGGGAAAGCGG + Intergenic
1003165093 6:3670592-3670614 CTGGGTGGACTCAGGGCTGAGGG + Intergenic
1003252249 6:4440304-4440326 CTTTGGGGACTCAGGGAAAAAGG - Intergenic
1003456463 6:6287310-6287332 TGGTCTGAACTCAGGGAGGACGG - Intronic
1004307334 6:14512801-14512823 CTGTGTGACCTCAGTGGTGAAGG - Intergenic
1004411684 6:15386924-15386946 TTGTGTAAACTCAGAGCAGATGG + Intronic
1004684930 6:17934253-17934275 CTGTGTGAGGTCAGAGCAGAGGG + Intronic
1005133556 6:22540131-22540153 CTCTGAGGACTCAGGGAAAATGG - Intergenic
1006110508 6:31741853-31741875 CTGCTTCAACTCATGGAAGAAGG + Intronic
1006129232 6:31859374-31859396 CAATGTGAACTCAGGGAACTGGG - Exonic
1010065942 6:71682357-71682379 CTCTGAGAACTCAGGGATAAGGG - Intergenic
1010390030 6:75326332-75326354 CTTTGGGGACTCAGGGAAGTGGG + Intronic
1010698718 6:79013088-79013110 CTGTGTGAACTCAGTAAATTGGG + Intronic
1010769272 6:79810130-79810152 CTGTGTGAGCTTAAGGCAGAAGG + Intergenic
1010863055 6:80937519-80937541 CTGTGTCACCCCAGGGAAGTGGG + Intergenic
1011713051 6:90074407-90074429 CGCTGGGAACTCAGGGACGATGG + Intronic
1011860738 6:91753022-91753044 CTGTCTGAACTCAAGGGGGAAGG + Intergenic
1012983446 6:105853369-105853391 CTGTGTCCACTCAGGGTAAATGG - Intergenic
1013055085 6:106575419-106575441 CTGTGAGAACGTAGGGACGACGG + Intronic
1013729926 6:113153638-113153660 CTGTGTCATCTCATGGCAGAAGG - Intergenic
1013830704 6:114269255-114269277 CTGTGTGATATTAGGTAAGATGG - Intronic
1014419920 6:121230945-121230967 CTTTGGGGACTCAGGGAAAAGGG - Intronic
1015128684 6:129785349-129785371 CTGGGTGAACTGAGGGTGGATGG + Intergenic
1015380021 6:132556437-132556459 CTTTGGGGACTCAGGGGAGAAGG - Intergenic
1015494515 6:133865993-133866015 CTGAGCCAACTCAGGGCAGAAGG - Intergenic
1017248429 6:152253182-152253204 TAGGGTGATCTCAGGGAAGATGG - Intronic
1017453248 6:154574378-154574400 CTTTGGGAACTCAAGGCAGAAGG + Intergenic
1017555859 6:155567459-155567481 CTTTGAGAACTCAGGGAAAAGGG - Intergenic
1017565147 6:155675986-155676008 CTTTGTGAAATAAGGGAAAATGG - Intergenic
1017590835 6:155976498-155976520 CAGTGTGTATTCTGGGAAGAGGG - Intergenic
1017795470 6:157840268-157840290 CTGAGGGAGCTCAGGGAAGAGGG + Intronic
1017992549 6:159504149-159504171 ATGTGTGATCTCCTGGAAGAGGG - Intergenic
1019924723 7:4184629-4184651 CTGTTTAAACTCAGAGAGGAAGG + Intronic
1020635383 7:10690611-10690633 CTTTGGGGACTCAGGGAAAAAGG + Intergenic
1020774754 7:12439263-12439285 CTGTGAGGGCTCAGGGAAGCAGG - Intergenic
1020967302 7:14887454-14887476 CTGAGTGTACACAGAGAAGAAGG - Intronic
1021806854 7:24366098-24366120 CAGGGTGAACTCAGAGAAGTAGG - Intergenic
1021996246 7:26180550-26180572 CTGTGAATACTCAGGGAAGTGGG - Intronic
1023963931 7:44951629-44951651 CTGTGTCATCTCATGGCAGAAGG + Intergenic
1024017441 7:45329796-45329818 CTGTGGAAACCCAGAGAAGAAGG - Intergenic
1024446402 7:49484547-49484569 ATGAGTGAATACAGGGAAGACGG + Intergenic
1024951150 7:54861610-54861632 CTGAGTGACATCATGGAAGAGGG - Intergenic
1026001487 7:66562195-66562217 CTTTGGGAAGTCAGGGCAGAAGG - Intergenic
1027194588 7:76020917-76020939 CTTTGTGAAATCAGCAAAGAAGG + Intronic
1027238777 7:76314046-76314068 GGGTGGGAGCTCAGGGAAGACGG - Intergenic
1027358276 7:77381623-77381645 CTGAGGGAACCCAGGGAAGCAGG - Intronic
1027542966 7:79491731-79491753 CAGTGTGAAGACAAGGAAGATGG - Intergenic
1027743327 7:82040649-82040671 CTGTGTGGAGACAGGGAAGATGG + Intronic
1028492293 7:91425596-91425618 GTGTGGGAAGTCAGGGAAGTGGG - Intergenic
1028726908 7:94098123-94098145 CTTTGGAAACTCAGGGAAAAGGG + Intergenic
1029129221 7:98317584-98317606 CGGTGTGAACTGAGGGATGAGGG - Intronic
1029504320 7:100953085-100953107 ATGTCTGTACTCAGAGAAGATGG - Exonic
1029504626 7:100955341-100955363 GTGTCTGTACTCAGAGAAGATGG - Exonic
1029505159 7:100959208-100959230 ATGTCTGTACTCAGAGAAGATGG - Exonic
1031089990 7:117342886-117342908 CTTTGGGGACTCAGGGAAAAGGG - Intergenic
1032022902 7:128419906-128419928 CTGGGTGAAGTCAGTGGAGAAGG + Intergenic
1033655186 7:143368481-143368503 ATTTATGAACTCAGGGGAGAGGG + Intergenic
1033771907 7:144561826-144561848 CTCTGTGATTTCAGGGAAGTCGG - Intronic
1034051604 7:147989924-147989946 CTGTGCTAACTCAGGGCAGTTGG - Intronic
1035204951 7:157289277-157289299 CTGTGTGAACTGAGGGAAGTCGG - Intergenic
1035383253 7:158453607-158453629 CTGGGTGAGCTCAGGAAAGAGGG + Intronic
1036481893 8:9147385-9147407 GGGTGTGAACTGAGGGAGGAAGG + Intronic
1036743572 8:11388719-11388741 CTGTGTTGACTCTGGAAAGAGGG - Intergenic
1038859216 8:31367889-31367911 CTCTGAGAACTAAGGGAACATGG + Intergenic
1038924086 8:32118416-32118438 CTGTTTGCACTCATGGTAGAAGG - Intronic
1039045907 8:33449200-33449222 CTGTGGGCACTGAGAGAAGAAGG + Intronic
1039839694 8:41284916-41284938 GTGTCTGACCTGAGGGAAGAAGG - Intronic
1039842075 8:41301148-41301170 CTCTGTGAGCTCCGGGAACAAGG - Intronic
1040949164 8:52918781-52918803 TGGTGTGAAGTCAGTGAAGAGGG + Intergenic
1042914293 8:73859898-73859920 CTGTGTGTGCTTAGGGGAGATGG - Intronic
1043584273 8:81749145-81749167 ATCTGTGAAGTCATGGAAGAGGG + Intronic
1043691621 8:83160474-83160496 CTTTGGGGACTCAGGGAAAAGGG - Intergenic
1044760404 8:95511629-95511651 CTGTGTCACCTCATGGCAGAAGG - Intergenic
1046812288 8:118546085-118546107 CTGTGTGAAGGCAGGAATGATGG - Intronic
1047593638 8:126353873-126353895 CTTTGGGAACTCAGGGGAAAGGG + Intergenic
1047606824 8:126482901-126482923 CTTTGGGAACTCAGGGGAAATGG - Intergenic
1048243188 8:132764824-132764846 CTGTGAGATCTCAGAGAATAAGG + Intergenic
1048867835 8:138773703-138773725 CTGTGGGTGCTGAGGGAAGACGG + Intronic
1050441550 9:5669290-5669312 CTTTGGGGACTCAGGGAAAAGGG - Intronic
1050471464 9:5995605-5995627 CTGGGAGATCTCTGGGAAGAGGG - Intronic
1050756893 9:9015815-9015837 CTTGCTGAAGTCAGGGAAGATGG - Intronic
1051455066 9:17246556-17246578 CTGTGTTTACTCAGGGACTAAGG + Intronic
1051873522 9:21766833-21766855 CTGTGTCACCTCATGGCAGAAGG + Intergenic
1052220022 9:26009263-26009285 CTGCGAGAGCTCAGAGAAGAGGG - Intergenic
1052733410 9:32315981-32316003 CAATGTGAACTGAGGGAAAATGG - Intergenic
1053139619 9:35674434-35674456 CTCTGTTCACTCAGGGAAGGAGG + Intronic
1053188675 9:36040770-36040792 ATGTGGGAAGTGAGGGAAGAAGG + Intronic
1053727413 9:41017968-41017990 CTGTGTCCACTCATGGTAGAAGG + Intergenic
1054701101 9:68414144-68414166 CTGTGTCCACTCATGGTAGAAGG - Intronic
1055840109 9:80493519-80493541 CTGTGTCATCCCAGGGCAGAAGG + Intergenic
1056832865 9:89930890-89930912 ATGTGTGGACTGAGAGAAGAAGG + Intergenic
1059007046 9:110414355-110414377 ATGTGTGAACTTAGGTAAGGTGG - Intronic
1059217203 9:112575148-112575170 CTGTGTTAACTGAGGGAGAAAGG - Exonic
1059542310 9:115143113-115143135 CTGTGTGAACACAGGGAAAAAGG + Intronic
1060538502 9:124412383-124412405 CTGTCACAACTCTGGGAAGACGG + Exonic
1061243165 9:129386167-129386189 CTGTGTGGCCTCAGGAAAGCAGG + Intergenic
1061544833 9:131298621-131298643 CTATGTGCACTGCGGGAAGAGGG - Intronic
1203781645 EBV:104283-104305 CTTTCTGACCTCGGGGAAGATGG + Intergenic
1185609960 X:1388389-1388411 CTGTGAGGACACAGGGAAGACGG + Intronic
1186383536 X:9086316-9086338 CTGTGTGATTTCAGGGAATTAGG - Intronic
1187677829 X:21735532-21735554 CTGTGTGATTACAGGGAACAAGG - Intronic
1187720362 X:22144051-22144073 CTATGGGACCTCAGGCAAGATGG + Intronic
1187921841 X:24211079-24211101 TTGTGTGAACTGAGAGAATATGG - Exonic
1188002457 X:24995200-24995222 CTGTGTGAACTCAGGGTATGCGG - Intronic
1191629187 X:63302735-63302757 CTTTGGGGACTCAGGGAAAAGGG - Intergenic
1192252307 X:69422711-69422733 CTGTGTCCACTCAGGGTAAATGG + Intergenic
1193636243 X:83952754-83952776 CTTTCTGGACTCAGGGAAAAGGG + Intergenic
1194075954 X:89394280-89394302 CTCTGTGGACTCAGGGGGGAAGG - Intergenic
1195903206 X:109819529-109819551 CTGAGGGAGCACAGGGAAGATGG + Intergenic
1196038288 X:111171699-111171721 TTTTGGGAACTAAGGGAAGATGG + Intronic
1196199306 X:112867463-112867485 CTGTGTGTTCTCAGGGTAGCAGG - Intergenic
1199183581 X:144888491-144888513 ATGTGAGGACTCAGAGAAGAAGG - Intergenic
1199677357 X:150199592-150199614 CACTGTGGACTCAGGGGAGAGGG - Intergenic
1200421966 Y:2979696-2979718 TTGTGTGAACTGAGAGAATATGG - Exonic
1200845134 Y:7824471-7824493 CTGTTTGGACTCAGGCAACAGGG - Intergenic
1200897729 Y:8393452-8393474 CTACTTGAACTCAGGGAACAGGG - Intergenic
1201303651 Y:12532196-12532218 CAGTGTGGACTCAGAGAGGAAGG + Intergenic