ID: 1077797686

View in Genome Browser
Species Human (GRCh38)
Location 11:5508865-5508887
Sequence ACGTAACCCTGCCATGATGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 46}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077797686_1077797688 9 Left 1077797686 11:5508865-5508887 CCTGCATCATGGCAGGGTTACGT 0: 1
1: 0
2: 0
3: 3
4: 46
Right 1077797688 11:5508897-5508919 AGTGTCTGCCGCATAATTTCCGG 0: 1
1: 0
2: 0
3: 6
4: 71
1077797686_1077797689 10 Left 1077797686 11:5508865-5508887 CCTGCATCATGGCAGGGTTACGT 0: 1
1: 0
2: 0
3: 3
4: 46
Right 1077797689 11:5508898-5508920 GTGTCTGCCGCATAATTTCCGGG 0: 1
1: 0
2: 1
3: 4
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077797686 Original CRISPR ACGTAACCCTGCCATGATGC AGG (reversed) Exonic
900716844 1:4150497-4150519 ACGTCGCCCTGCCCTGACGCTGG - Intergenic
904900415 1:33852610-33852632 ACATGGCCCTGCCATGATCCTGG + Intronic
918062376 1:181073066-181073088 AGGTAACTCTTCTATGATGCAGG - Intergenic
1075680770 10:124329701-124329723 AAGAACCCCTGCCATGATGCTGG + Intergenic
1077464143 11:2725616-2725638 ACGTACCCTTTCCATGAGGCTGG + Intronic
1077736275 11:4794912-4794934 ACCTCACCCTGCCATTTTGCAGG - Intronic
1077797686 11:5508865-5508887 ACGTAACCCTGCCATGATGCAGG - Exonic
1078677345 11:13434786-13434808 ACGTAACTCTGCCATAACACTGG - Intronic
1098360745 12:69652137-69652159 AGATAACTCTGCCCTGATGCTGG - Intronic
1103421536 12:120788615-120788637 ACGTACCCCACCAATGATGCTGG + Intronic
1110456086 13:75691859-75691881 CCCTAACCCTGCCATCCTGCTGG + Intronic
1121524621 14:94611219-94611241 ACGTCAGCCTCCCAAGATGCTGG + Intronic
1126400215 15:48260782-48260804 AGTCAACTCTGCCATGATGCTGG + Intronic
1129179591 15:73865601-73865623 ATGTAACCCTGCAATAATGGGGG + Intergenic
1140228968 16:73101649-73101671 ACGTCACCCTCCCATAGTGCTGG + Intergenic
1165279281 19:34782862-34782884 ACACAGCCCTGCCATGATGGAGG + Intergenic
927380015 2:22468382-22468404 ACGTAACACTGCCATGAGTTGGG + Intergenic
929667307 2:43842973-43842995 AAGTACCCCTGCAATGATGGGGG - Intronic
937951303 2:127389819-127389841 ACACATCCCTCCCATGATGCAGG - Intergenic
940073624 2:149717071-149717093 ACTTAACCCTGCCAAGAGCCTGG - Intergenic
947684814 2:232073664-232073686 AGGTAACCTTTCCATTATGCTGG - Intronic
1174409390 20:50324028-50324050 ACTTAACTCTGCCGTGGTGCAGG + Intergenic
1176031830 20:63016539-63016561 ACGTGACCCTGGCATGATCCAGG - Intergenic
1176264189 20:64200142-64200164 CCGTGTCCTTGCCATGATGCTGG - Intronic
1177935592 21:27341336-27341358 ACATAACCCTGCCACCATGCAGG - Intergenic
1177983331 21:27943058-27943080 ACCTAACCCTGCCATTAAGGGGG - Intergenic
1182356485 22:29724514-29724536 AGGTCACCCTGCCAGGATGTAGG + Intronic
951750978 3:26036215-26036237 TCTTAACCATGCCCTGATGCTGG + Intergenic
952052331 3:29399584-29399606 ATGTAATCAGGCCATGATGCTGG - Intronic
988434375 5:31156390-31156412 CTCTCACCCTGCCATGATGCTGG - Intergenic
990864838 5:60369001-60369023 CCATAACCCAGCCATGGTGCTGG + Intronic
1002491719 5:179582904-179582926 ACATAACCCTGATATGATGGCGG - Intronic
1004338418 6:14785109-14785131 TTGTAACCCTGCCATTGTGCAGG + Intergenic
1005250608 6:23941916-23941938 ACATAGCCCAGCCATGATGTTGG + Intergenic
1011703021 6:89972839-89972861 ACCTCACCCTGCCAAGGTGCTGG - Intronic
1013255797 6:108384155-108384177 ACTTTACCCTGCCCTGAGGCTGG - Intronic
1019256878 7:58019-58041 CCGTTTTCCTGCCATGATGCTGG - Intergenic
1021869169 7:24986638-24986660 ACGTGAGCCTCCCAAGATGCTGG + Intergenic
1023052129 7:36262223-36262245 ACTTCACCCTCCCAAGATGCTGG - Intronic
1031436045 7:121733131-121733153 AGTTATCCCTGCCATGATGATGG + Intergenic
1032154618 7:129458000-129458022 AGGTAACCCTGCCATTAGCCAGG - Intronic
1033677602 7:143558398-143558420 ACATAACCCTGCCATCTAGCTGG - Intergenic
1033694232 7:143771042-143771064 ACATAACCCTGCCATCTAGCTGG + Intergenic
1034001704 7:147420603-147420625 ATGCAACCCTGCCTTGGTGCTGG - Intronic
1034501194 7:151452069-151452091 ACAGAACCCTGCCAAGATGGTGG - Intergenic
1045796574 8:106052505-106052527 AAATAATCCTGCCATCATGCAGG + Intergenic
1059035875 9:110752979-110753001 AAGTAAACTTGCCAGGATGCTGG + Intronic
1062645217 9:137544313-137544335 AGGTGACCCTGCCAGCATGCAGG - Intronic
1187276794 X:17823452-17823474 ACATAAGCCTGGCATGGTGCTGG + Intronic
1193972245 X:88068866-88068888 TTGGAACACTGCCATGATGCTGG - Intergenic